Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name LEU4
Systematic Name YNL104C
Strain S288c
Description Alpha-isopropylmalate synthase (2-isopropylmalate synthase); the main isozyme responsible for the first step in the leucine biosynthesis pathway; LEU4 has a paralog, LEU9, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>LEU4 YNL104C
TGGGACTGCTCCTGCTTCATCGTTCACAGTGGAAAAAAAGGAATAAAAGTGCTTATCAGA
AGTGCGCTTTATTGACGAGAGTCTGTCTAAACAGTTGACGGACAGGCAAGAAGACCTTCA
GGAGTTGACTAATATATGAAATGATGTGCGTTCAAACAGACCGTTTCACCTGGCACAGAT
GCATGTAAACAAGGATATACGTTATTACATGCTACGGCTACATCTAGATTGGGTGGATTT
AAGTTGAACGATGAAAGAAAATTCAAGCAATATGCTTGTGTGGCCCGATGACACACAATA
GCATGTGCGACGAGACACCAGCTGTGTGCCGGGTGCTACCCGCGCACGTGATTAAAAGGA
AACGGGGAAAAAGCCATAGCGGAAAAGTGCTCGAAGAAGCCTCGATAAATGAAGTAAAAA
ATTCGATATTTTTCAACGACAATAAGACGTATATAAGCATCCGTATGTCCAGCGATTGAG
CTTATGCTTCTGTTCTCCGCTTTGACACTTCCACTCGGCTGTTATGACCAGCCCCAGGAT
TGCTACCGGAGCGGGACCGGCTCTGAGACAGTAGTAGGTTAGTCATCGCTCTACCGACGC
GCAGGAAAAGAAAGAAGGCCTCAGAAAAGCTGAGTTGAATGTGTGTCATACTTGGCTGAA
AAAATTGTACAGTAACGGCCAGTCACTGTCATGCGCGTGCATGTATGTGCGTGCATGTAT
GTGTGTATGTATATTTATATATATATAAGCACGGGCGCATGGGAGATGTGCGCTATGGAG
TCGCGTAGGTTCGATGTTTTCTCCTCTTGGGTCAGCCTCTCTCCTCTTTCAACGTTCTTT
CCATAATCATTTATTGGTTATTTTTCAACTTGACCAGTAAAAAGAAACTTACGTGTAAGT
GACTCAGTTCTTTCAAAGGGTATTTTTTGAAGAAAAAAAAGGATTCTCACACTAGAAGTT
TACTGTAGACTTTTTCCTTACAAAAAGACAAGGAACAATC
Chr coordinates Chr XIV from 426754-424895
w3c xhtml validator w3c css validator