Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YAF9
Systematic Name YNL107W
Strain S288c
Description Subunit of NuA4 histone H4 acetyltransferase and SWR1 complexes; may function to antagonize silencing near telomeres; interacts directly with Swc4p; has homology to human leukemogenic protein AF9; contains a YEATS domain
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YAF9 YNL107W
CGTCCAATTCATTTCTTCCCCATTAGTTAAAAAGGAGGTGTTGCCATTCATTGTAAGTTT
CCACTCTCTCTCTTCAAATGGTATACTTTCATTTTCTCCTTTCACCAGCTCAAATTTATC
AATAGCACAACTTCCATTTCTTATAAAGGTGCCTTTGTTATCAATGGGCTCTTTGGCACT
GGAGAATTTCAACAAGTTCATACCAAGAGCGGATTTAGTGGCTGCGTGGGTAACTATCAT
AATGGTCTTTACATTTGGAAATTTTCTCTCCACTCTGTCAATAAAGACAGGCCAGAATTT
ATGGCACCTCTCAAAAATATCTTCTTCTGTTTCACCCTTATTACTAGGAATAATACTAGG
TTCCCAGTCTGGAGAGATCATGCTTGGAAAAAACTTACTCATAACTTCATGAGTAGCAGG
CTCCGGGATAATGGGTCTATCAGGCTTATACCATTCTCCTACACCACGATCGACATATAA
TGGAATCTTTAAAGCCTCCACTGTGGGTTTACTAGTTTCTAAACAGCGGTAAAATGGGGA
GGAGAAAATCATTTCTGGTTTGACATCTAATTTAGAGATATAGTTCGCCAGTTCATGTGC
CTGTTCAACACCGTGTTCCGAAAGCGGGACATCGTTATCAATACCGGTGGGCGGTGGTGG
ATATGGTCCCTTTGGTAGCCAGTTTGACCTGTAACCATGTCTGGCAATGTATATATTTTC
GATAGCCATAATTTATAGCACTATTTTAACCTCTTGTACAACTAATTGAACGTCTTACAT
ATTGAACGAAACTGCTTTACTTCTAGGATTGTTTTCAAAGCTTTTTTATAAATTTCGAAA
TATCCGCTATTCGGATGACGTGATGACGCTTCGGCACCATTGATTATTTTTCCAGAGTTT
AGATGTCTTCTATGTGCAACTGAACAAGTAGCCTTCGAAAGCTAGAGGGATAGATACATT
ACTTGTGACCACCTATTTACGGCATCACAAAGAAAGCGAG
Chr coordinates Chr XIV from 420098-420778
w3c xhtml validator w3c css validator