Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name DMA2
Systematic Name YNL116W
Alias CHF2
Strain S288c
Description Ubiquitin-protein ligase (E3); controls septin dynamics and spindle position checkpoint (SPOC) with ligase Dma1p by regulating recruitment of Elm1p to bud neck; regulates levels of eIF2 subunit Gcd11p, as well as abundance, localization, and ubiquitination of Cdk inhibitory kinase Swe1p; ortholog of human RNF8, similar to human Chfr; contains FHA and RING finger domains; DMA2 has a paralog, DMA1, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>DMA2 YNL116W
TACCTGTCATCGGAGGGGTGTTCATGCCATGGGTGGTATGGCTGCGCAAATCCCTATCAA
AGACGACCCGGCAGCCAATGAAAAGGCCATGACTAAAGTCCGTAATGATAAGATTAGAGA
GCTGACAAATGGACATGATGGGTCATGGGTTGCACACCCAGCACTGGCCCCTATTTGTAA
TGAAGTTTTCATTAATATGGGAACACCAAACCAAATCTATTTCATTCCTGAAAACGTTGT
AACGGCTGCTAATCTGCTGGAAACCAAAATTCCAAATGGTGAGATTACTACCGAGGGAAT
TGTACAAAACTTGGATATCGGGTTGCAGTACATGGAAGCTTGGCTCAGAGGCTCTGGATG
TGTGCCCATCAACAACTTGATGGAAGACGCCGCCACTGCTGAAGTGTCTCGTTGTCAATT
GTATCAATGGGTGAAACACGGTGTTACTCTAAAGGACACGGGAGAAAAGGTCACCCCAGA
ATTAACCGAAAAGATTCTAAAAGAACAAGTGGAAAGACTGTCTAAGGCAAGTCCATTGGG
TGACAAGAACAAATTCGCGCTGGCCGCTAAGTATTTCTTGCCAGAAATCAGAGGCGAGAA
ATTCAGTGAATTTTTGACTACATTGTTGTACGACGAAATTGTGTCCACTAAGGCGACGCC
CACTGATTTGAGCAAATTGTGATCTCCCTTGCCCCAGTGTACACATATATAAAAATATAT
TCATGCCTATATGATTATGTATCGGAATCCAAAAACTTATCTTTATATTGCTTCGTTTCG
TAGTTAGCAATGAATCATCTTATCATGATTCCTTTTTTTGTTTTGGCCAGATTAATGTAT
CACGGTCGACGGCGAAGGCATCAACCATTGTTGTGGAATTTCAAACACAATACTTGATGA
CTCCAAACGTGGGCATATATTTTGATTTGAAAAGAAGTCGAGAAAGTATAGCAACGCATT
GTATACGTTTGAAGCTTTCAGCAAAGGATATACCGTGGAA
Chr coordinates Chr XIV from 408341-409909
w3c xhtml validator w3c css validator