Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MLS1
Systematic Name YNL117W
Strain S288c
Description Malate synthase, enzyme of the glyoxylate cycle, involved in utilization of non-fermentable carbon sources; expression is subject to carbon catabolite repression; localizes in peroxisomes during growth in oleic acid medium
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MLS1 YNL117W
TTTAATCTTTAGGGAGGGTAAAGTTGGATTCATCAATTTGATGAAATCCGTGTAAAACCA
TGAGGCTTCTTCAAAATGAAATAACTCTCTCTCGACACTCGATAAATCTTCATTCGGACA
ATTTATAATAAAACGTACTAATAAGTCCTCTAAAATTCTATCAACAGAAGTAACGTTCTC
CAATGCGTGTCGTAGCGGCAGTGACATTGTCTAATGCGAAGGTACTTTTATTTTTTTCAG
ATTCAAAGCAATATTATTTAGACAATTGATACTAAGTGAGCTTAAGGAGGATTAAACAAC
TGTGGAATCCTTCACAAGGATTCAATATTTGTTTTTCCTGGTTATTTTGCCATCATTCAA
CTTTCCTCAGACGTAAAATTCGTGCTTAGTGATGTCTCAATATTCCCGCAGGGTAATAAA
ATTCAATAACTATCACTATATACGCAACAGTATTACCCTACATTGCTATCGGCTCAATGG
AAATCCCCATATCATAGCTTCCATTGGGCCGATGAAGTTAGTCGACGGATAGAAGCGGTT
GTCCCCTTTCCCGGCGAGCCGGCAGTCGGGCCGAGGTTCGGATAAATTTTGTATTGTGTT
TTGATTCTGTCATGAGTATTACTTATGTTCTCTTTAGGTAACCCCAGGTTAATCAATCAC
AGTTTCATACCGGCTAGTATTCAAATTATGACTTTTCTTCTGCAGTGTCAGCCTTACGAC
GATTATCTATGAGCTTTGAATATAGTTTGCCGTGATTCGTATCTTTAATTGGATAATAAA
ATGCGAAGGATCGATGACCCTTATTATTATTTTTCTACACTGGCTACCGATTTAACTCAT
CTTCTTGAAAGTATATAAGTAACAGTAAAATATACCGTACTTCTGCTAATGTTATTTGTC
CCTTATTTTTCTTTTCTTGTCTTATGCTATAGTACCTAAGAATAACGACTATTGTTTTGA
ACTAAACAAAGTAGTAAAAGCACATAAAAGAATTAAGAAA
Chr coordinates Chr XIV from 406358-408022
w3c xhtml validator w3c css validator