Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name FYV6
Systematic Name YNL133C
Strain S288c
Description Protein of unknown function, required for survival upon exposure to K1 killer toxin; proposed to regulate double-strand break repair via non-homologous end-joining
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>FYV6 YNL133C
AAGAATACACATACCATAGGTATTACCCAATATTTTCTCACTCTCTTTGTAGTATACATA
TCTGATATTTTGGTTAGAGATAAAAGATTCAAAAGGGTCCATTTCATTCACTTCCCTTGT
ACCTCTTTTAATTTCTTTCTTAATTTTATTCTCTCTTTTTTTTCTGTGCGAAGTGAATCC
TAGAAGCTTCTTCTTATAAGCCCATAAGACGGACTTGTTCATCTTAAGGTCAGCACTCAT
CATCAAATAATGTAAATTTGGGAGCTGGTTACGTGCCCTGTCCCCAACGATGACAAATAT
GGACCTTTGTTTGGTTTGAACACCATTCCTGATCAGTGACGGGATTCTTGAATCGATAGC
TTTTTTGGCCATTTTCTCCTTGTTTTATAAGTCTCTTATAAGTCTTTGCAAGTTAAAAAC
TAAGAAATATAAAAGGTGACTTGGCTTATATACTCTATTGCGTACTTTATTTGAGATAAA
TACAGAATCTCCATGCATCTTCAGCACCTCATCTCATCTCATTGTATCTTGGCTCTTCAT
TTTTTTTTTTCAAAATTTTTCACACGATTCCGGGTAAACTATTACTTTTTACAACTAATT
CAGATATACCTGGGAAGTTACAATGGAAAACATGCAATGTTCGGTCTGGCTTGTATCATT
TGATTGGAAAAGCGAGCATCGGTTGATACTGAACACATCCACATGCGTAATCATTAAAAA
AAATTTTTCAAATTGCGAACTCTGTGGATCGAACACAGGACCTCCAGATGACTTGACCGA
AGTTTTTCTTCAGTCTGGCGCTCTCCCAACTGAGCTAAGTCCGCTTATTTTTCTGAAACC
TTTTCCGCCTTTTTGTCGTCCCTAGGAATTACTTTTGATGCACTGCCAATCTGAGGGAAA
AATGACGTTTAAACGCACGAGAATGTGCAATTAGATGTAAGTCCATCGAAGCCTAGAGAA
AGCGGTTCCAACAAAAGACTGTGGGCTCTGTTATATCATC
Chr coordinates Chr XIV from 374692-374171
w3c xhtml validator w3c css validator