Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MEP2
Systematic Name YNL142W
Strain S288c
Description Ammonium permease involved in regulation of pseudohyphal growth; belongs to a ubiquitous family of cytoplasmic membrane proteins that transport only ammonium (NH4+); expression is under the nitrogen catabolite repression regulation
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MEP2 YNL142W
CTGTTAATATTTAAATTTCTGCTAGTCATTATCATATTGCAATGGCTTTTATTAGTGAAA
GCCACTGTCAACAGTAACTGAGCTACTCCCTCCAATGTTGTCTAACTCTATGCTCTTTTT
GGCGTCTGAATGAGCCATAACGAGGGAAATAACTGTATCAGGAATACTAACAGAATACAG
ATTGGATGCACTGGTGCTGGTGAGTTTTCTTTTTCTGATATTATTGGATAATATTTTCAG
CTATAGACTATCATCATTCAGCATTGGTCACGCTAAAATATACGTTCCATGCATACGTGA
TAGCCTACTCGGTTGTCAACTTCATTTTATAGGCTGCCTGGTCACCGATTACCGCCCCGC
TCAGCAGGACGGTTTAAGCTTCTGTTCTTGGAAACGACGTAATTCATGTCGGCCATCGAA
ATCATTCCTGGCTTTGTAATAGTCATAATGAACAAGGAATGCTGTCTTGGGTTTTTTTCC
CTTTGCGAATACCCGGGCTGCCAAAATAGAAAAGGAACAAATGGTAGGTCTTTAAGATAA
GAAAGATAAGATAAGACATCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCCGATAAC
AAAGAAGAATCCTTCGGTCTCTTCTTACTGCTGTTACTGCTTATCAAGAGTGTCTGGTAA
TAGTCAAAGCCAGATAAGATAAGAAATGTAAAATCGACTATTTCCCTCGTAAAAAGCTTC
AATTGCTCACGCATCGACGAATACTAAGCGGCGTGAAGACCCTGTGCCTTATCAATGAAG
TATTCAGTACAAGAGGTGTTCATTCCGAGCCACTTTTCTGCACCATATATAAGCAGTAGT
TACACATGTGCTAACCAAACATCAGTGGGTAGTAATCATTCGTGCTTTCACGTCCTTTCA
AATTAAATATCCTTCTTAAATAATAAGTCTGCACAGAGCTTTGAAAGAAGTTTAGTTTTG
TAATATATCATACTTAATATATTACAATACAATATCAACA
Chr coordinates Chr XIV from 357453-358952
w3c xhtml validator w3c css validator