Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name IGO1
Systematic Name YNL157W
Strain S288c
Description Protein required for initiation of G0 program; prevents degradation of nutrient-regulated mRNAs via the 5'-3' mRNA decay pathway; phosphorylated by Rim15p; GFP protein localizes to the cytoplasm and nucleus; similar to Igo2p
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>IGO1 YNL157W
ATGTCGAATGAAAACTTATCTCCCAATAGTAGTAACCCAGATTTAACTAAACTGAATAAC
GGCGAAAGCGGAACTATTGATACCAGCAAATTCTCGCCCAACGAAATGAAGCTATACAAA
ATGTACGGAAAGCTGCCATCAAAGAAAGATATTTTTAAGCATACCATGCAGAAAAGAAAA
TATTTCGACAGTGGTGATTACGCTTTGCAGAAAGCTGGCATTCAAAACAATGATCCAATA
AACTATGGAAAGAATAACCTGCCATTAACAAATCCCAGCAAACTACGAGAAGATATAATA
AAAAGAAGGATAAGCACTTGTCCGTCAACTGCCTCAACCGCTGGTGTAGTAGATAATGCG
ACGTTGATACAAAAGGAGGGAAGTATATCGAGTGGACCACCATCGTCTAATAACGGTACT
ATTGGAGGTGGTAGTACAAGTTCAACGCCAGTGGGGAACCACAGCTCTTCGTCGTCCAGT
TTGTATACTGAATCACCCATTAGATAA
Promoter Sequence
Download FASTA
>IGO1 YNL157W
TCTCACTAAATGCTTGTGAGGATGTATGCGTTTGATTCGGTGTCTCTTTAATCATATTCC
CGAATCGACCCTATTTGAAGGTAGAGGGAGTTGTTTCCTCTCACTATTGTTATAAAAGAT
CATCAATGACGGAAACTAATATGCAATGAAAAAATGAGAAGTTTACATGAATATGAAGAT
TAACTGCACAGCAATGTTGTTGACCCTTGGTATTCGCACACACTAAGCCAACATAGGTTC
GTTCAATTTTTAAAAAGAAGATGGTCCGGCCTCAGAATGTTCACTGGTTTATCGCTACAA
TTGTATTTTTCATCGGATTTGTACACGCTAATACAGAATCAATCTTATATAAGGTTCCTC
ACAACTTTCCCCTCAAAAAACCAAGAGACAGCTCTACTTATGCAAGAGATGTAAACTTGA
TATCTTCCATATCACTATCGGGAGAAGCAATGAGTCAGATCACTATCGAGGCCAATACCA
CTGACTTGGAGTTGCATAATACTACGTATATTGAACTGGCGGACTTACAGCGAGACGAAA
CATATCAGATTAAAGTGTGTTGGTCAGCAATACATCCAATTTCCATTAATAATCTCCAAA
CTATCACAATACCACGTTTCACTGAATTTCAGGGAACTAAGTCAGACTACGCGAGAATAC
TAGTGACTTTCCAGGTCTTGTCTGACTCGTATCCTAGTGAGCATGCCATGGTTCCAATAC
AAGTCTCATTAATCACCACTCGGCTAGGTATCCCCGTGGATATTTACCCAACATTAATCG
TTATGGTGCTATTAGTAGCAGGGCTTGTTGTTACCCGGGCACCACACGTATTGAACGATC
TTTTGCTGAAATTTTAGTATGGAAGCCTGAGCCCCCTTTGGCTGGATAGCTTGGCCTCAT
CACAACTAGAACGTAAAAAAGTCCATTAACCATCAAATGCTTCTCATTAAAGTGGGTATT
TTTATCGAAAGAAAGGGACCTGAATATCTAACTCGCCGCT
Chr coordinates Chr XIV from 340352-340858
w3c xhtml validator w3c css validator