Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YGP1
Systematic Name YNL160W
Strain S288c
Description Cell wall-related secretory glycoprotein; induced by nutrient deprivation-associated growth arrest and upon entry into stationary phase; may be involved in adaptation prior to stationary phase entry; has similarity to Sps100p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YGP1 YNL160W
AGCGTGCTATTTTTTAAAAAGGGCAAATTTAGGAATGTCTGACGGAATCCCTAATCATCT
TTGGCTTTTCCCTTCACTCCCTTCTTTTACCGACGATGGTTTGAAGGAAAGAGAAAAATG
AGCAATAGGAAAATTCAGTAGTCGATTTCCATTTCAATTCCCTATTGGGTAATGTGGCGG
CGAGGGCTAAACATTCGGTATCATTGATTCAATGTTCTCACAATGTTCAAATTCTCGGAT
CGGGTATCCCTAATTGGGATCTCTTTCCAGAGGAAGGGGCCTTGATGTGGGATTGAAGAC
ACATGAGTTTTTTTCTCACCGTCGAAACTTTTGCTTACCCGTAAAACATCGGCCATTCGT
TGGTTTATTATGTGACTTTTTTGTGACTTTTTTTTTTGCGAAGTTTTCTCGTCATCCGCG
GAAGATCCGGCGGGCGAAAAAGTCTCTCACTTTTACCCAATCGGGGCATGTTATGTGGAC
ATGTTATGTGTCCAAGAGACACATGAGCCCAAAAAGGGTACACTGTCTAAATAGTTTACC
CTTTACGAATCGAAACTTCTCGAAGAAGGGGCCGAAAATTAGCGCAGAAGTTGACGAAAG
TTTATACTTTTCCTAATGGAGAGGCTCAGGAGCTGAAAAGGGATATATTCGTACTCTATT
GCATCTTCAAACTCCGAAGAATCTCAGTAGGGAGTGAAGCCGGCTTCTCGATGCTACAGT
TCAACATCGATACTTTGAAGAAAGAAAGCGCCTATTATATCTCTTTTACCCTATTAGTAA
TAATTAGGAAAAAGGGAGAAAAAAGTACCTCACTAAAAAAACCATCATCTCTGAAATATA
AAAAGCTTGATAGAGGGTGACATTTGCTAGAACTTCTGCTGTGTTCTCTTGGGTTATTGC
TCTTATTGAATATCCCTTCTATTTCTTTCTTGCTTGTAAAAAATCAGCTCAAAAAACATC
TACAGGATTAATCGTCAGTTAAGTAATACAGTAATAGAAA
Chr coordinates Chr XIV from 336545-337609
w3c xhtml validator w3c css validator