Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RPL42A
Systematic Name YNL162W
Alias eL42, L41A, L42A, L44e, YL27
Strain S288c
Description Protein component of the large (60S) ribosomal subunit, identical to Rpl42Bp and has similarity to rat L44 ribosomal protein
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPL42A YNL162W
TTAAAAGATGTCTGATAAGCCCGACTCCCAAGTATTTTGTCCAAATTGCAATGAAAGACT
TCAAAAGTGTTTAGTACAGCAAAATTATGCCATTATAATATGTCCCAGCTTAGTCTGCGG
CTACCCATTCAATCAAAGAGAAGTACTCGAAAATCTAACGTATGTAGACGATAATGACGT
CTTAAAAGTTGCAAAAAAAAGATTATCTTCACGAAGCAAACCATAAAATAGTTGCACTAT
TGCTGTTCATTATCTTTCATTATCCCTAGTAACGCCATTGCAGAGTCAAATATGAGCGAT
AACAATATAAAGAGCAATAACATGATAGTTGAAATTAACATAAAAGAAGCGACATAATTA
AAGGTCTCAAAGAGTGAAGATCAAGTATCCGGTTTTTACGAATAATCTACTTTCTATGTG
AAACCCAAAAAAGTTCGTACAAGGAAAACTAAAAAGTGTGTAATAACTTGTCTAGCTTTG
GCATTAAAACTTGTCAATTATTCATCACCAATATAGACTAATGCGTTTTGGAACGCCAAA
CCGCAGTGACAAATAGCAAATATGTAGCTGTCATATCGGCATATAATAACAGTTTTCTAC
CAAATGCTGTCCTACATTCAGAGATCTTACATCCTTACATCTAAAGTAAAACCTAGACAT
TTACTTCGAGTTATACTTTTTTTTTATTTATCTATTTTTTCTCTTGCGGACATTTAACAC
CTGAATTCCGCCTAACGCCAGGACTGATCCTGCCAGGGAAGGGAGCTTTGTCTAGTGCCA
ATAGGCCGGACCAGTAGGAAGGTTACAGCAGCTGGCCCGCAGAGTGATTGGGTCACAGGA
AATAGCGCAACCTTCTCTTTTGCCCGGGAAAGGCGGTTCAATCTACCTTCGAAGGGCTAG
TACATGAGCGCGAAGGAGGCAGATAATAGCACCATTAAGTGGTCCAAATGCATCTTGAAA
TCTAATCCTTAATAGAGGAAAACAACAATTATCAGTAAAA
Chr coordinates Chr XIV from 331322-331325,331838-332154
w3c xhtml validator w3c css validator