Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RPL42A
Systematic Name YNL162W
Alias eL42, L41A, L42A, L44e, YL27
Strain S288c
Description Ribosomal 60S subunit protein L42A; homologous to mammalian ribosomal protein L36A, no bacterial homolog; RPL42A has a paralog, RPL42B, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
Hide Seq
>RPL42A YNL162W
ATGGTTAACGTTCCAAAGACCAGAAAGACCTACTGTAAGGGTAAGACCTGTCGTAAGCAC
ACTCAACACAAGGTTACTCAATACAAAGCTGGTAAGGCTTCCTTGTTTGCCCAAGGTAAG
AGACGTTATGACCGTAAACAATCTGGTTTCGGTGGTCAAACCAAGCCTGTTTTCCACAAG
AAAGCTAAGACTACCAAGAAGGTTGTTTTGAGATTGGAATGTGTCAAATGTAAGACCAGA
GCCCAATTGACCTTGAAGAGATGCAAGCACTTCGAATTGGGTGGTGAAAAGAAGCAAAAG
GGTCAAGCTTTGCAATTCTGA
Promoter Sequence
Download FASTA
>RPL42A YNL162W
TTAAAAGATGTCTGATAAGCCCGACTCCCAAGTATTTTGTCCAAATTGCAATGAAAGACT
TCAAAAGTGTTTAGTACAGCAAAATTATGCCATTATAATATGTCCCAGCTTAGTCTGCGG
CTACCCATTCAATCAAAGAGAAGTACTCGAAAATCTAACGTATGTAGACGATAATGACGT
CTTAAAAGTTGCAAAAAAAAGATTATCTTCACGAAGCAAACCATAAAATAGTTGCACTAT
TGCTGTTCATTATCTTTCATTATCCCTAGTAACGCCATTGCAGAGTCAAATATGAGCGAT
AACAATATAAAGAGCAATAACATGATAGTTGAAATTAACATAAAAGAAGCGACATAATTA
AAGGTCTCAAAGAGTGAAGATCAAGTATCCGGTTTTTACGAATAATCTACTTTCTATGTG
AAACCCAAAAAAGTTCGTACAAGGAAAACTAAAAAGTGTGTAATAACTTGTCTAGCTTTG
GCATTAAAACTTGTCAATTATTCATCACCAATATAGACTAATGCGTTTTGGAACGCCAAA
CCGCAGTGACAAATAGCAAATATGTAGCTGTCATATCGGCATATAATAACAGTTTTCTAC
CAAATGCTGTCCTACATTCAGAGATCTTACATCCTTACATCTAAAGTAAAACCTAGACAT
TTACTTCGAGTTATACTTTTTTTTTATTTATCTATTTTTTCTCTTGCGGACATTTAACAC
CTGAATTCCGCCTAACGCCAGGACTGATCCTGCCAGGGAAGGGAGCTTTGTCTAGTGCCA
ATAGGCCGGACCAGTAGGAAGGTTACAGCAGCTGGCCCGCAGAGTGATTGGGTCACAGGA
AATAGCGCAACCTTCTCTTTTGCCCGGGAAAGGCGGTTCAATCTACCTTCGAAGGGCTAG
TACATGAGCGCGAAGGAGGCAGATAATAGCACCATTAAGTGGTCCAAATGCATCTTGAAA
TCTAATCCTTAATAGAGGAAAACAACAATTATCAGTAAAA
Chr coordinates Chr XIV from 331322-331325,331838-332154
w3c xhtml validator w3c css validator