Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name BNI5
Systematic Name YNL166C
Strain S288c
Description Linker protein responsible for recruitment of myosin to the bud neck; interacts with the C-terminal extensions of septins Cdc11p and Shs1p and binds Myo1p to promote cytokinesis
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
Hide Seq
>BNI5 YNL166C
ATGGGCTTGGACCAGGACAAGATAAAGAAGAGGCTTTCTCAAATAGAGATAGATATCAAC
CAGATGAACCAGATGATTGACGAAAATTTACAATTAGTTGAACCTGCGGAGGACGAAGCT
GTCGAAGATAATGTCAAGGATACGGGTGTGGTCGACGCTGTAAAGGTGGCAGAAACGGCT
CTTTTTAGTGGCAATGATGGAGCGGATAGTAACCCAGGAGATTCAGCTCAGGTTGAAGAG
CACAAAACCGCACAGGTCCATATTCCCACTGAGAATGAAGCGAATAAGAGTACGGATGAC
CCATCCCAGCTATCGGTTACTCAACCTTTTATAGCGAAAGAGCAGATAACTCACACCGCC
ATTGCTATTGGTGACTCCTATAATTCATTTGTCGCAAATTCCGCTGGAAATGAAAAGGCA
AAGGACTCCTGCACTGAGAACAAAGAAGATGGTACAGTCAATATAGATCAAAACAGGGGT
GAAGCTGATGTTGAAATTATCGAAAATAATGATGATGAATGGGAGGATGAAAAATCGGAT
GTTGAAGAGGGGCGAGTAGATAAGGGAACAGAGGAAAACAGTGAGATTGAATCTTTCAAA
TCACCCATGCCCCAGAATAACACCTTGGGCGGTGAGAACAAGTTAGACGCTGAACTTGTA
TTAGACAAATTTTCTTCCGCTAATAAGGATCTAGATATACAACCGCAAACCATAGTTGTA
GGAGGTGACAATGAATACAACCATGAGAGCAGCCGTTTAGCTGATCAAACACCCCATGAC
GATAATTCAGAGAATTGTCCCAATCGCTCTGGAGGAAGCACTCCCTTAGATTCTCAAACT
AAAATTTTTATCCCTAAAAAGAATTCTAAAGAAGATGGTACCAATATAAATCACTTTAAT
TCAGATGGTGATGGACAGAAAAAAATGGCGAATTTCGAGACACGACGCCCTACAAATCCG
TTCAGAGTTATCTCGGTGAGCAGCAATTCCAATTCAAGAAACGGAAGTCGTAAATCTTCA
CTAAATAAGTATGATTCGCCAGTCTCCTCTCCTATCACATCAGCGTCTGAGCTGGGCAGT
ATTGCCAAGCTGGAAAAAAGACATGATTATTTATCCATGAAATGCATTAAGTTACAAAAG
GAAATTGACTATCTAAACAAGATGAATGCACAGGGTTCTTTATCTATGGAAGACGGAAAG
AGACTACATAGAGCCGTAGTGAAGCTTCAAGAATATCTTGACAAGAAAACGAAGGAGAAA
TATGAGGTCGGAGTGTTATTAAGTAGACATCTGAGAAAGCAAATTGATCGTGGCGAAAAT
GGCCAATTTTGGATTGGAACTAAATGA
Promoter Sequence
Download FASTA
>BNI5 YNL166C
GCATTTTTCCTTTGATTGTAATTAATCATGGGGATATGAACATCAGGTTCATCTTTTCTA
TGAAATATAAAATCGTGCTCTACCCTGCTCGAAAAATTATGGCTTTCCATTTTTTTTAGA
ATAGTGCAGAATTCATATTTATATATGGAGACATTTTCGTTTATTCGAGAGACCACTTCT
GAGTTTAATGGAGGTTTATCGCATTGGGAGTCTATCATAACGTATTTATATATCCTCATT
ACCGGTGTATTTTGATCACTGAAAAGCGACTTGACCAGGTTTAAAGAAATGGCGTGAAAT
AGGGGAAGTCCTAGACCCCTCTTTGGATCAATGTTATCGAGCTTCCTCTTGTTGTGTAAA
AATAGCTGGAGAGATTCTTCACTGGGGAATGCAAAAAACCCTCGTTGTAGTAGCACCGAA
ACGAATGGCATGGCTCTTTCTGACGTGAATCTTGGGGCTCTGTTAACATAACCCTGTCTT
TGTAGGTCTCCAATTGTTGAGCCTTCTGATACCGCTGTATTCAAAGTAGCTGCATCCGCA
CTATCATCGCCCTCGTTGGCAGAGGTTTCCAGAGATTCATTTTCTCGTGCAAATATTGTA
GATTGGTCGTCTCCATAACCATTAGCTCCCAAGAGATTGACGGTGGATGGAGACCCACTG
TGAGGATACGGAGGATGTTGGCGATTATGTCGGCGTCCCCGGCGATTTCCAATCAAAGAG
CGTACTCTATCCATGCGGATCTTTGGCAAATGTATGTAGCACTTCTCCTATCGTTCAATT
TGATGCTCTTTCTTTTCCAAAAGCCTTACTTGTTCTTCTTCTTCACTAGTAGTGAAGGGC
TTTAGAGATGCCCAGAACCCAGACCATTTTAGACGCGTTATGAAATAAATATTGCGCTGA
AAATTCAAACTTCATAATAAACAAAAATCATTAATAGTTTTGTAATTTGATTTACTGTTA
TGGTGATGCTATGTTAGTGTGAAATAGAACAACAGAAACG
Chr coordinates Chr XIV from 323565-322219
w3c xhtml validator w3c css validator