Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PSD1
Systematic Name YNL169C
Strain S288c
Description Phosphatidylserine decarboxylase of the mitochondrial inner membrane; converts phosphatidylserine to phosphatidylethanolamine; regulates mitochondrial fusion and morphology by affecting lipid mixing in the mitochondrial membrane and by influencing the ratio of long to short forms of Mgm1p; partly exposed to the mitochondrial intermembrane space; autocatalytically processed
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PSD1 YNL169C
CCATTGTCTTCATCATTGGTCAAGACCACTAGACCTGCAAACTCGACTTTCAATGGTTTA
AATGAAGACGGAACTAACCCCGGGCCCATTTTTATCCCACGCGGTGTGAAGGTTCATCAC
GAAATTGAGTTGGCATTGATTGTGAGCAAACATTTGTCCAATGTCACTAAGATGAAACCC
GAAGAAGTCTATGACTCTATTAGTGGTGTAGCTCTAGCATTGGATCTTACAGCAAGAAAT
GTCCAAGATGAAGCCAAAAAGAAGGGGCTACCTTGGACTATAAGCAAGGGTTTTGACACC
TTCATGCCAATCTCTGCTATAGTCTCCCGCGAGAAGTTCTCATCCTACAAATCAAACTTA
CAGGATATTTTCAGAGTCAAGTGCTCTGTTAACGGACAGTTGAGACAAGATGGTGGTACT
AACCTCATGTTGCACCCACTCCATAAAATACTGCAACACATATCTACCATGATATCTCTG
GAACCGGGTGATATCATTTTGACTGGTACACCTGCAGGTGTAGGCGAGTTAAAGCCTGGT
GACCGTGTTCACTGTGAGCTATTGCAGAATAATGACAATATTGTCGACATGAACTTCGAA
TGTGAAAATCGGCCGGGACCATATGAATTTAGAGAAACATAATGTCTGTCGCATTCACGC
TTGTCGCAGATAACACGTTATGCGTTACTAATTTCCTACAAGCTTGGCACATATACGACC
AATTGTGCTTCTGTATACGCTACGCTATGTAATCACATATCACATGCAGGGTAACCAGCA
CCTTTTTGGTGTTTTTTCAAATCTCGAGGTCAAGGGACATCTAAAGCAGGCACAAGCATG
TGGAAAATTTGTTCTTCACCTATAATATAAAACAGCTTACTCACAAAAGAGACGCCTAGA
GGTACGTAGCGCTTTAAGGACTCTTCAGCCAGTTGTTAGCAGATCGCTCAAATCCTTCTT
GGTCGTTATTTTTTGAAGAAGAAGGAAAAGCAAAGCCAGC
Chr coordinates Chr XIV from 317671-316169
w3c xhtml validator w3c css validator