Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RHO5
Systematic Name YNL180C
Alias YNS0
Strain S288c
Description Non-essential small GTPase of the Rho/Rac subfamily of Ras-like proteins, likely involved in protein kinase C (Pkc1p)-dependent signal transduction pathway that controls cell integrity
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RHO5 YNL180C
GAGAAAGCAACTAAAAAATGTCAAACAAGCGTCCTTATTTCATTCTACAGCGGTTAATTT
CAAATACCCTAATCGGAGGTCTTATCTTATTTTTCAAGGGCAAGGCTCTCCACATCGGTA
AGTGATGACCAGATAATGGAAAGTAGCAGAATTTTATTTATGTGCCATACAAGCCCGGAG
AAACAGAGTAGCTAAAAAATTAAGGTGTGCAAAAGTGGTTTTGTTCCCCGACGCCCGGGC
CTTTCTCTCCCCTGAATCTTTTCGTTCCGGCCCCCCTCTCTCAATACCAGATCTGCATCT
ATACTAAAGCTGCAGTGAGAGTAAACCGGAAAATTATCCTGCGTGTTTGCTTCGGTCTTA
GCTTTTACTTGGGTATGCGAGAACCTCTAAGAGCTTAGACCGGTCTTCCTCCCTAAAAAG
AAAATTATAAAAGGTTATTATCTGGACTAAAGCAAAAAAAAAACAACGTTTCGGCGTCCG
CTCAAAATTTTCATTACGCTTCTTGGTCAAATCAGTTACGTAACGGGTTATGACGAATAC
GATGAGATGAGTAATTGCAGAAGGCTCCTATGCAGACAGCTAAGCAGTGCTTACTTGAAT
TACCTTCCCTTTTATTTCTTGATATATCGTCCTTTTTCTCTCTATCTTAGTTCTTGCGAG
TACTGGCAATCATGTTTCTCCTTTTTTTTTCTTTTTTTTTTATTTTTTTTTTTTTTTTTT
ACTTTTCAGTTTCTCGTAGCTTTTCCTATTTTGCTATTTAAAGTAAGTTTAAATAGTACC
CTCACTAAACACGTACGGCCGATCCACCAACGAACAAAAGCACGATCCTTGACCCATCAT
TGTATTCCAAAGCGTTGGAACATTCACTTTTTTTTTTCCGGTCTATTGCACAAGACAATA
TCCAGAATATTCAGTTGGATAGGAAATACAAGACAGGTGGCACCCACAAAGCACACGCCG
AAATATTTATTAAATACAATATAGTATACTAATAAGTCTG
Chr coordinates Chr XIV from 300649-299654
w3c xhtml validator w3c css validator