Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name NPR1
Systematic Name YNL183C
Strain S288c
Description Protein kinase that stabilizes several plasma membrane amino acid transporters by antagonizing their ubiquitin-mediated degradation; phosphorylates Aly2p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>NPR1 YNL183C
TTACTCAAAACAAATCATTAGAACTATCCAAACTTTAACTACATCACAGGATTCAGTTGG
AGAAGTGACCAATCTCTTAACCAACCCTTACAGACTCGAACGTGGAAATTTACTTTTTGA
AGGAGAATCCAAAGGCAAACAACCTAGTAATAATAATGGTCACAATTTTATGAAGATACC
AAACTTACAAAGAGTTATCTTTGATGGTAAAAACAAAGGCCATTTACACGATATTTGGTA
TCAGATAGGAGAACCAGAAGCAGAGACAGATCCTAACCTCGCATTACCACTTAACGACTT
TAATGCCTATTTGGAGCAGGTCAAAACGCAAGAATCGATATTTTCACATATCGGTAAGGT
GTCAAGCAATGTAAAAGTGATTGACAATAAAATCGACGCCACTTCATCTTTAGACAGCAA
TGCCGCTAAAGATGAGGAAATTACAGAACTTAAGACCAACATAGAAGCATTAACTCATGC
CTACAAGGAGTTACGTGACATGCACGAAAAGCTGTACGAGGAACACCAACAGATGCTTGA
CAAGCAATAAACGGAATAGTCGCGCATTTTGTACAATAAAATAGGAATGTTATTAAAATA
TACAGCATAGATAGATATAATTCATCACTTGTGCGAAACATCTCATTCTCAATCTGACTG
ATCATCTATTACGGAATTTTTTCGTTATCAATGACGCATCCCACAATTCCTACCCTTATA
GCTTATCTCAGAATATGGGCCGCCTTTAGTTGTATAGAGTTAGTACGGATTAGTCAGTGG
CGTACCTAGTGGCAACAATCGGCAGTGACTAAAAATCTTGCTTTTGTTATTGAAAGAATA
ATAAACAGGAGTTCTCGTTCCTTTGCGTCATTTTCAACCCCATACAAACTAGTTGGCTTG
TACCAGAACTCATTAATACTTTTGTCTAACTCTTTCCTATTTCTGATTTTCCAACAGCTC
ATACCCATTCAAACAAAAAAGGAAAGCTCTACGAAACATT
Chr coordinates Chr XIV from 295509-293137
w3c xhtml validator w3c css validator