Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name DUG3
Systematic Name YNL191W
Strain S288c
Description Component of glutamine amidotransferase (GATase II); forms a complex with Dug2p to degrade glutathione (GSH) and other peptides containing a gamma-glu-X bond in an alternative pathway to GSH degradation by gamma-glutamyl transpeptidase (Ecm38p)
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>DUG3 YNL191W
TCCGCTGGGTAAGATTAATACTACAGAAGATGGTACGTTCAAAATGGAAGTTCTGGTCTC
TAGTTCAGAGATTCAAGCAAACTACGATAAATATTTGAAAGTTTTAAATGACTTCGATCC
AAAATCAGAATCTCGGCCTACTGAGCCATCTTATGATGAAAAAAAGACTGGCTATTATGC
AAACGTTAGATCTCTCGTGATTATCTTTTGGGTCATCACAAATTTCATCATCGTTGCTGT
TGTCTTAGAAACCGGTGGGATTGCAGATTATATTGCTATGAAATCCATATCAACTGATGA
CACTTTAGAAACTGCAAAGAAGGCGGAAATTCCCTTAATGACCAGTAAGGCCTCAATTTA
TTTTAATGTAATTTTATGGTTAGTTGCATTATCGGCATTAATAAGGTTCATTGGTTGCTC
AATATACATGATAGTAAGGTTTTTTAAAAAGGTTACATTTCGCTAAGTAGATTGATTACC
CCTTTGTTATAAATAAGTATATGTGTTTACTATCATATAATAATTAATTAGTTGTAAGTA
TGGTATTTTTCAAAGAAACATTTAGTATTATTTTTAAAGGGTGCCTTTACCATAAAACCA
AAAAAAAATGGCTTCTGAGAGAAAAACATAAATAATTGATAAAACTGAAACTCACAACAC
CAACTCTTCCGCTCTAAACACCCAAAGCTCAAAAAACGACATGTGCACATCTATATCCAT
AAACTTTCAAAAAAGTGGTTCATTCGCAAATTCATGAAGTATTATTTAATACACAGTAAT
CTGGCATTTCATACTATCATTGCTCAAATTATCCGCCGGACCCTTGAAACTGTGGCGCTT
TTTAAGACGCATCTCCAAAAAAAGAAAAAGAACAAAAGAAAAAAAGCTGCAAATATATAT
ACAAAACAGATTTCACGTTTATTGCTTGGGAGTAAGGTAACGATCCGGAAGCCTTGAAGA
AATTTGAATGTATCCAACTAACTATTGAAAATCATTCGTG
Chr coordinates Chr XIV from 280432-281505
w3c xhtml validator w3c css validator