Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YNL193W
Systematic Name YNL193W
Strain S288c
Description Putative protein of unknown function; exhibits a two-hybrid interaction with Yhr151cp in a large-scale analysis
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YNL193W YNL193W
GGCTGAGCTGCCATCTTAGAAGAGCAGTTGACTGCTATTCCGCGGCTTTCCCAGCCGCAC
CAGTTATAATTGTACCATCTGGTTACGGAGGGCGCCGAGTTAAAGCCCGAAGTGGATGCC
TGAAACCAATAAAAATTCTTCAACACTCCTGTGGTCCTGCCACCTGCTAGTATCAGAAAA
AAAGTCAACAATGTAGCCCCTAGTAGAAAGAAAAGGTTAATAAAGTACACAAACTTTTTG
TAGGACATTGATTATTAGAAACGGAAATATATGAGGTTATACTTAATGCTTATCGTGATC
GCAATACAAGTAATTGTTTATGGTTGTTTGAAAACCCTAGAAAAGTGGCTAATTTCGGAT
AAGAATTACAGATAGGATCTCTAACATAATATAAGTTGTTAGGGTATTTAGCTAATGTTT
TTATATCGAAAGCAGGGGATAACAGCGGAGACAGAAAACAGGGAATAGTGATCTCATCTT
TCCATCCGTTCATCCCACTTTTACGTCCTTGTAAATAGTACAAACTGCGGGTAGTAATGC
AAGATTTGATGATATACAGGGTGCTTTTGCATTGCAACCCCCTCCCTTAAAAGACGCTGG
GGAGCAATTTTGTTCTAGAAGTCCCCTCTTTGTCGTCTTCCCAAATCCGACTTGTGCGGC
TGTGCGGCTGTGCACTTCAGGGGGTGTCCTTGCCGTAATTTCGAGGAGTCTTTGTAAGTG
ATTAATTTTCTCAAAAATTCAACGTATGAAAAGGTGATAGTTTCGGCATCTGCGATATTC
TTTTGGACCAGTTAGTGATGACGAAGGCCCTTAAGATTATGTTGGGAGCCAAATTTTCGT
AGTTGCATACGTAATTTTGAATTTGATTTGCTTTTTTTTCTTTTTTGCCTTGGCTTTCCG
TTGATGCGGATTCTTGAGAGTTCTAAAAGTTTATGTATACAAACACCGCATTGAATGCTT
CGCCTCTTAAGCAGACAACTAGAGTATTGTAAACCAGGTA
Chr coordinates Chr XIV from 274368-276044
w3c xhtml validator w3c css validator