Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name WHI3
Systematic Name YNL197C
Strain S288c
Description RNA binding protein that sequesters CLN3 mRNA in cytoplasmic foci; cytoplasmic retention factor for Cdc28p and associated cyclins; regulates cell fate and dose-dependently regulates the critical cell size required for passage through Start
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>WHI3 YNL197C
CACGACCAGTAATGCGACTACGGTCTCATCAGTTCCTGATCCCAAATATAATATCAACTA
CAACGACATAACCTCCTTCAATTCAGTAGCGCTAATTACCGAAGATCTTAACATATCTGC
ATCATCTAATGGTCTGCATGAGAGAGGTAAAAAGCTACTGCAGCAAGAGATGGAATACTC
AAACAAGGTCAAAAATGTCACCATCGGGCTTGAAAGATTGTGTATGGATGAAAAACCAGT
CCCAGATGCAGGAATAACCATGCAACAAGCGTCGCGCTGGTCAGAATTCCCCACTTGTTG
CGATCAAGCTGCTATTTAGCTTTTCTAATTTAAAAAATTTATAAACTTCTTATAGTATTT
CATCTTTATATCAAATACTATTAGCAAAATAAAAGGAAAGGAAAGGGAAAGGAACTTCTT
TAGACTGCTTCGCACTGATTCTATCGCCATCCTTCTTCATGTTCTCAACTATTGGATATC
TGCTCTATTTAGAACAATCGTTATTGTTACCCGCGTTAAATGGGGTAACTGATTGCTGCT
TTTTTTTCTCGTTGTTTTGGACCTTTTCGGACATGAGAGGTCAAAAGAAAAAACAAACAC
GACCAAGTAAGCCGGAATAAACAAGTATAACCACCTGATTGAATTGCCTTCTTTAAACAA
GCACAGACCTCCAAAAAGAAAAGGCTTTTGAAACGCTGCTCACGCACAGTTGTTTATTCC
GTCCACATATTTTACGTGTCAGTTTCCTTTCTGTCTTCTCTTTATTCAATCAATTAGCAT
TAAAGAGAAAATAAGTCGTGTACTTTGAAAACCTTCTGTTCCTGTTTTCTTCCCGTATTT
TTCATTTGCTTCACCAGCTTTTTCTCAACTGATCATATCATTTCAAGTTAAAAGTCTTTG
TCATCACTTTTCTGTGAGTTGCAAATATTTGTAAGCGTCACTTACCTAGAGCAGCCTTTA
TCGATCAATATTTCAGAGGGAAAAACCTGTATCTCTTAGC
Chr coordinates Chr XIV from 269593-267608
w3c xhtml validator w3c css validator