Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YNL208W
Systematic Name YNL208W
Strain S288c
Description Protein of unknown function; may interact with ribosomes, based on co-purification experiments; authentic, non-tagged protein is detected in purified mitochondria in high-throughput studies; potential orthologs found in other fungi
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YNL208W YNL208W
TGTAAAGAAAACACTTTGTTGGGTGAATTCGACTTGAAGAACATCCCAATGATGCCAGCT
GGTGAACCAGTCTTGGAAGCTATCTTCGAAGTTGATGCTAACGGTATCTTGAAGGTTACT
GCCGTCGAAAAGTCTACCGGTAAGTCTTCTAACATCACTATCTCCAACGCTGTCGGTAGA
TTGTCTTCTGAAGAAATTGAAAAGATGGTTAACCAAGCCGAAGAGTTCAAGGCTGCTGAT
GAAGCTTTTGCTAAGAAGCACGAAGCTAGACAAAGACTAGAATCCTACGTCGCTTCCATC
GAACAAACCGTCACTGACCCAGTCTTGTCTTCTAAATTGAAGAGAGGTTCCAAGTCCAAG
ATCGAAGCTGCTTTGTCCGATGCTTTGGCTGCTTTGCAAATCGAAGACCCATCCGCTGAT
GAGTTGAGAAAGGCAGAAGTTGGTTTGAAGAGAGTTGTCACCAAGGCCATGTCTTCTCGT
TAAGATGTCATTCTGGTTAAGGTTATACACATATATATATTTTTCATTTTTAATGTCTTA
GCTTTTGTATCTTAGATGAAGTTTTAGTTCTGTATATCACGATCAAGATATCATACAATC
ATAAATTCAATTATTCTTCTGTTTCCCCTCTTGAGGCATCAAACGAGTGTTTGACTGATA
CACACCAACATACTAAGGCAACTTTTCTGGCTGCCCAAAGCTGTGGCACGTATGAAACTG
CTTTTCGGCTGCATAAAACAACCATGTGGAGTTTTTACTGTATTCGCATTTCGCCCCGCT
AGCATTCTTCGTTCATGCTAAAAATGAGGCGTGGGCTAATATTCAGTATTAATAATTCCG
GCACCCGCACAGCCCATACCGGAAAAGGGGCTGGCTGTTGGGCTTGGCAAAAAACTCAAT
CTGAGCAGTCATTTATAAAGAAAGACTTTAATTTGTCTTGCTAAACACTTGTAAGCCTTC
CAAATATAGATCACTTAAGACAATCTAACAAGTGTCCAAA
Chr coordinates Chr XIV from 254418-255017
w3c xhtml validator w3c css validator