Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PDR16
Systematic Name YNL231C
Alias SFH3
Strain S288c
Description Phosphatidylinositol transfer protein (PITP) controlled by the multiple drug resistance regulator Pdr1p, localizes to lipid particles and microsomes, controls levels of various lipids, may regulate lipid synthesis, homologous to Pdr17p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PDR16 YNL231C
TTTCAAAGACGGCGGATTCAACATTGCAAAAAGGCATGCGCAACGTGTGGCCTTTGGTGG
CCAAGCGGGCGGACAATCGTCTTCCCCCAAGAAAGGCCCATTGTCCATCAAACCGGAGCC
TGTTAAGGTAAATCGTCAAATGGATAATGTCACAGCAGAGAAGAAAGATGTTACGCAGCC
CATCACGCCGGTGAAGAAGAGAAGATCCGAATCACCGTCAATCTTTCTCAATCGTAAAAA
ACCTGCGCTATTCAGGCCTACTCCGAAGACAAACGCTGCAGGTTCTCGACCCCATACAAC
AGCGATCACCAACGATCACCGTACTACTTCTCATCCTTATCCCCACAAAGATGTTGTAAC
TTCAATATCAAGTGTCACCGCAAATCCCGTAACAAAGGGCCACAAGAAGAAGAAATCCGG
AATTTTCGTACGAAATGCCGGATCTGACGGAGATAGTTTTCCGCACGTGACCGCAACCGG
CCCTACTACCCGTCCGTATATCTATGAGCCACGGAAATAGCAGTAACCCAACTCCGAAGG
CCGTCACATCCCCTGCGATTTCCCACGGGTCCAGTCATTCCGCGGAGAAAGAAAGCAACC
GGAAGCAACGGCATCCCTGCTTATAAGCGATTTTCGCGTTGCGCGTCATCTTTTTGTCTT
CCGTCTTAGTAATTTTTATGATTTTTTTCATTCCACCCGACTCTATTTGAGTGCAAGCAT
GCGATATATCTCTCTATATATTGCCAGATCTTTATCGCAATAGGTTCATGCACTATATGC
GCATCCCACTCTTGTACATGCACAATATTGTGCTCATTGTCTGAATATATATATATTTAT
ATATATATATGTATGTATATATATCAGTTCTAGATAGACTAATACCACTTCTTCGTTAGA
AAAATATTTCAATCCTTATTTTGTTTCTAACTGTTCCCTTCTCTCCATCCAACAAATAAT
ACAAAACCACTTTATATAAAAAAAATTACAAAAGCAAAAA
Chr coordinates Chr XIV from 217042-215987
w3c xhtml validator w3c css validator