Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name NAR1
Systematic Name YNL240C
Strain S288c
Description Component of the cytosolic iron-sulfur (FeS) protein assembly machinery, required for maturation of cytosolic and nuclear FeS proteins and for normal resistance to oxidative stress; homologous to human Narf
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>NAR1 YNL240C
CTGCTAACAAGTATTGCACGAGACGTGAGTCGATGTCTTGATCAGCCGAGGAGACGATTT
GGTCCAAGAAATAGTTGGCCTTTTCCAACTTATCGTAAAAGAACAAGTAAGCTTGGGACA
GTTCGAATTCTTTTAAGTTCAATTCAGAAAGAACATTCAAGCGCAGTTGATTGGTAGCGG
CAAACAACCAACATCTACCAGAGCTTTTTTGGTTGGTGACTGGAGTGGAATCAGTAGAGA
CAACAGTGTTGAAAACCCTGTTATCTTGCTTTTGCAGTCTAGTCTTGTTCAACAGTGCAT
CATCGGCATTATAATTCTTAAGGACAGTGGTTGCCAATTGATGGGTTAAGTCGGATTGAA
ACTCTTTGTTCCAAGAGTTGATCTTACTGATATCGATGGAAGAGGACATTCTTTTTAAAA
CAATTTGTGGTGCTCGTAAAAGGTGGCTTCTAAACGTCTTGAGATACAAGGACCGGGAAA
CAGAAGTAGGAAGCATGTAACAAAAGAGCAAGGGCTATTTATCGTTTATTTATGGGTGCC
CGTCGGCGACTTGTCAGCCGGCGTTATCAATTGATTACCACATGCAACCCCATTGATTAA
GAGAGCAGGTGACTTTCTGGTGGGAGGGGAAAAAAGGATGTGTCACTCACTACCCGGCGA
TTGCATGCTATTTGACACATACTAAAGCAAAATAACATATGTAGCATAATCAATAAAGCG
ACTATTTTCTAAATTTCAAAAAGCACTGAATATACGATGCCTCTTCACAGGATTAAGAGA
CAAAATTTGCCTGTTTGTAAAGCATATTGCCTGCCTTTCCGCTAGTTTTTTCTTTTCCAC
TTCCTATTTTCTTTTTTTACCAGTTTTCCCTGCTCATCGCATGAAGAAAAAAATGATAAA
AGCGTTTTATGGTGATGACTAAGAAACTTGTCTTGTCAGCTGGAAAGATAAGAGAGGGAG
CTTCCTTTTCCTGAGTGACAAGATAAGTGTACAAGAAAGC
Chr coordinates Chr XIV from 199977-198502
w3c xhtml validator w3c css validator