Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SUI1
Systematic Name YNL244C
Alias MOF2, RFR1
Strain S288c
Description Translation initiation factor eIF1; component of a complex involved in recognition of the initiator codon; modulates translation accuracy at the initiation phase
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SUI1 YNL244C
TACCCTTCGTCCGGGTCGGAAACTGAAACCAGTGACACATACTCCTCGTACTCAAACGTC
CCGTTGTTAAACCCTCTATGGTGCGCATGAAAGTCCAGCTTCAAAACCAGGTACCGCACA
TACTCCCGAATCAGTTTGCTGTACGACGAACCGCCAGAATGTACCCTACCCAGAGATCTG
ATCCAGTCCCTATCCCGGATGGCCTCAGCTAGCGCTGACGGATGTCCCTCTTGTATGATC
TTATGCAGTACAATAAGCATCTTGAACAGTTGCACTTCGTCATTGGCCAGAGGCAGCGTC
TTAAGGGTTGTAAAAACAGCTTTGGAAGACTGATGGTCCCATGTGTACACTATGCATGCG
CGTACGTGCTTTCTCTTAGGTGCGGTCTCCTCAACGGAACACGCCTTTTTAAGCGCTTTC
TGCAGATCTGAATCTATTCTGGACATCCTGTTCTAGCTGCTAGTACTATCACTACTACTG
CTATGGCTGTATTACTAATATTTCTATTGTTTCACTATTCTTTATATATATTTATATATG
TATATTTTCCAGCAAAACACCCTTTTTGGCATTCTCCTATAGGACGTCAAACGGCGCGCG
ACCGCGTCATTTTATACGAGCAGCCGCTGCGTCGTCGTACAAAACGCACCGACCTACATT
ACAATAAAAAGTACCCGTAAAAGGATCATGTGTACATGGTTCCAGTCTTTTGGTTCGGTA
CTATAACTACTGTAAACGACCCTCTCACTGCAGTTTATGATATGTGATCGCGTTAAAAAT
GGGTATTATCACCAATAACGGGTCGGGTAACAGATTTTTTCGATGCGCCGGCAAAAAATT
TTAGTTTTTTTTTTTTTCATCACAGGGATAAAAGCAAACTGCAAAAGGACAAAACAAGAG
AAGAGCTACTTGTTGTTTTCGTTTCGTGCTGGGGGTTTTCTCCTTTCTATTCTTTTTCAA
AAAAGACAAGGAATATATTAATATAGCTGAAGCAAATCGT
Chr coordinates Chr XIV from 187496-187170
w3c xhtml validator w3c css validator