Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SIP3
Systematic Name YNL257C
Alias LAM3
Strain S288c
Description Protein that activates transcription through interaction with DNA-bound Snf1p, C-terminal region has a putative leucine zipper motif; potential Cdc28p substrate
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SIP3 YNL257C
GAATCTGGAAACTTTTGAAAATACTCGTTATGGGCAATAACAGCTGACACAGATTCTACA
AGAGCTTCCACAGTCTTGAAATTTGATTCCTCCACAAACTTGACAACGTTATCAATTATG
CTTTGCACTGGCGGTGGCAATTCGGCTTTCTTTGGCCAAGGCAACTTTATATCCAAAGTT
ACATACTGTTTCTTAAGTCTCTCAAAGGTGAAAACACCAATCAAAGTCAACATTTTTAAC
TCAGATATCCTAACAACGTCAAATTCCTGTGATTCTGGATTCCCTCTTTCTTGTTGAATA
ATACAAGATATGTGGTCACTTCTAATATGCGTTGTATCCGCCTGCACTTCTAAATTCAGA
CACTCGACACCAGAATATTTGTCCATAACAAATTGAGACACAGATTTAGCCAAATTAGAA
ACAGAACCCCAATTCTTTTTTTTGCTGACGAAATTCGTCAAATCACGAGAAATAACTGCA
TAATTTAGAGAATATTTCAAATCATCCGTAGCCGCAGATTTACTAAAATCTGTACCCATA
TCTAAGCTTAGTAGACATTTCTGAGGCATTAATTGATTCCAGGAATCAGGCCCAAGAACT
GTATTCATCTCTAGTTTCTTAATGTGCACATAATCTCTCATGCCGCCTAGTGGTACACTA
TGTCTTGCAGAATTGACAGTAGAAAATAGCTTTGACATAGCCAAAGGCAAAGATTGAAAC
TTGTTAATCAAAGAAGACGCTATCACTTTTACTAATTTTGCATTTACTAAAGGAAAAAAC
CTTGTTCTTCTGTTTTCGATGACCTTGCAATTTATCATAAGTTTTTCAAATTTTCCTTTT
ATTATGAATTTGCGCAACGACACCAGCGCTATTGCTAATGCGTTCAAAACAGGGAAAGTA
CACGTGAAATTTTAAACTACTAGGTGTAACTAAAACATAGCTGCATGAGTAGACCTGTTG
ATCAATTGACATATTGCAGAGATATATCATTACTTGAAAT
Chr coordinates Chr XIV from 164320-160631
w3c xhtml validator w3c css validator