Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name LTO1
Systematic Name YNL260C
Strain S288c
Description Putative protein of unknown function with similarity to a human protein overexpressed in oral cancers; essential gene with defects in anaerobic and filamentous growth; localizes to the nucleus and cytoplasm
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>LTO1 YNL260C
TATATAACGATTGCGTGACAAAGGAAATATTAAAATGGCAGATTATCTCTGAGGTCAATT
CCGAAAATTTGGGTGAGCTCGTATCTTTATTAGTGAACAACACCGATATACAATTATTAG
CGAAGGAACCAAGTTACAAAAAGATGAGAGAAAAATTCGCCACTATGGGCAAGTTTCTAC
CATTACATTTAAAGGAGATTATGGAGATGTTTTACAATGGGGATTTTTATCTTTTTGCGA
CAGACGAACTAATCCAATGGATAGAGTTATTGTTTGCCGACACTCCCCTGCGAAGGAATG
CCATTGATGATATTTACGAAATTAGAGGCACTGCTCTAGATGATTAAAAAATAATTAATC
GTAGGATAGGTTACATGATCATTGCAATAGATGTACATCTTGTATTACGTATGCGTAAGT
TGTCTTTTTTTCAGTTTTCTAATAAATTTCACGTGATGCGGTAGTTTTTTTTGGGGGTGC
AAAGTTGGCACATCTTGTAGTGCATTTTTGAGCTTCTTAAATGACTTGAATCATCTTAAA
ACATTGCAGGATGAGATTTCCAACGACACAAGAGAGAACTAGCGCAAAAGATGGCAGAGA
TAAAACATTATCAATTCAATGTCGTCATGACCTGCTCGGGATGTTCTGGTGCAGTCAATA
AAGTTTTGACGAAATTAGAACCAGACGTTTCCAAAATAGATATATCCCTTGAAAAGCAAT
TAGTAGATGTATATACTACACTTCCTTACGATTTTATTTTAGAAAAGATTAAGAAAACCG
GAAAGGAAGTTAGATCTGGCAAACAATTGTGAATGAAAGTGAAGAGAAATAGTTTTTTAC
TCTATTTTGTATTGTAGCTACTTAAGTAAATGATTAATATTCTCAATAGGATGCTTACGA
AGAAAAAAGTCTTTTTTTATTGTTTTATTGTTTTATTCTTTGTTGGCTATGTAGCCATTT
GCCTTTTCAGTATAATCTTACTAATATAAAAATCTCAATC
Chr coordinates Chr XIV from 157455-156859
w3c xhtml validator w3c css validator