Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PDR17
Systematic Name YNL264C
Alias ISS1, SFH4
Strain S288c
Description Phosphatidylinositol transfer protein (PITP), downregulates Plb1p-mediated turnover of phosphatidylcholine, found in the cytosol and microsomes, homologous to Pdr16p, deletion affects phospholipid composition
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PDR17 YNL264C
TCTAATTTTATTGGTCAGGATAACTTTAACCAGTTTCAAGAAACGGTCAATAAAGCCACT
GCAAACGCTGCCGGCTCTCAACAAATTTCAACGTATTTTCAAGTCAGCACCCGTTATGTC
ATCAATAAATTGAAACTCATCCTAGTTCCTTTTCTTAACGGAACCAAGAACTGGCAACGA
ATTATGGACTCTGGCAACTTTTTGCCACCAAGGGATGACGTGAACTCCCCAGACATGTAC
ATGCCTATTATGGGACTAGTTACCTATATTCTCATCTGGAATACGCAGCAAGGTCTGAAG
GGTTCATTCAACCCCGAAGACTTGTACTACAAACTGTCTTCTACTCTGGCGTTTGTGTGT
TTAGATTTGTTGATTTTGAAGCTTGGCTTGTATCTTTTGATCGATTCTAAGATTCCAAGC
TTCAGTTTGGTCGAACTGTTGTGCTATGTCGGCTACAAATTTGTTCCATTGATTCTCGCC
CAGCTTTTGACCAACGTGACCATGCCATTTAACCTGAATATTTTGATAAAATTTTACTTA
TTTATTGCCTTTGGCGTATTCCTACTAAGATCCGTCAAGTTCAATTTACTAAGCCGCTCC
GGTGCTGAAGACGATGATATACACGTTTCCATCAGCAAATCGACCGTCAAGAAGTGCAAT
TACTTCCTATTCGTCTATGGCTTCATTTGGCAAAATGTTCTAATGTGGTTAATGGGTTGA
TCTTGATTGAAGAGATCAAAGAGAGGATTTAATTTCATGCGCATTATTATTATCTACGGT
CAATTTGTTAAATACTTATATACTTTTATTCCTACGTCATAAATTTTCTATTTACTTTTC
TTATTTTTCCTTTCACTCAATATGGAGTGGAAAGAGAACAATAGAGGGATTAAAATTCGT
GGGAAAAATCACGCTTTTTAGATAGATTTAATTTACATCATTGTTTAAAAAAAAAGACCC
TGAAAAATCACACAAAGAAAGCACAAGAAGAAGAACAAAA
Chr coordinates Chr XIV from 146615-145563
w3c xhtml validator w3c css validator