Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MET2
Systematic Name YNL277W
Strain S288c
Description L-homoserine-O-acetyltransferase; catalyzes the conversion of homoserine to O-acetyl homoserine which is the first step of the methionine biosynthetic pathway
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MET2 YNL277W
CCGCCGGCACCACAATTGCAAAACTCCCAAGCCCGTCCACAAAAGAAGGACGGATTCTCA
CAGTTCATGCCATCTGCAACTACGAAGAACCCATATGCCCAGTAACTCGACCGACTGGTT
GTAATTTTACAAAAAGAGAGACAATTAAGAAAAGAAACAAGCGCCAGGCTTCCGTATCCC
AGTTTTTCATCTCACTTTCTGGGCACGATTGTAATAATACTTCATGATAATAACTAAACT
ATATAAGTAGTGTCTCATCCGTAAATATACATTTAGACAGATTCTTGTATTTTCTCCGGG
CAATTTTTAACTTTTTTTCTGTTAGGGCACATGACACTTGCCTATTATGGACAGCCAGTA
AAGATGTGCCATATATTGCCCCCTTTACGCTCTCTGCCAGTATTAGTGGGAAAAAAAAAA
CTGAAAAAAAAAAAATCGCAGACTACTAATAATCACGTGATATTTCTTTTCACTCTCTTC
ATAAAGTTGCTAAAAACACACAATCGAATGAGCCTCTGAGCAGTATAAATTGTACTTCAA
AGCACTAGTCATGAAAAACGCTTACATTAGTTCAGTTTGTCAAGGTTATGCTATTACTTG
TACTTATTTCTTGCTATTGTTAGTGGCTCCCCACATTGACGTATTTTCACGTGATGCGCC
TCACTGCGGAAGGCGCCACACATTGCCTGCAAAAAATTGTGGATGCACTCATTTGATAGT
AAACTAAGTCATGTTAATCGTTTGGATTTGGCACACACCCACAAATATACACATTACATA
TATATATATATTCAAAATACAGCTGCGTCCAATAGATGAGCTTCCGCTTCGTTGTACAAC
CTACCTGCTATCTTGTTCACGGATATTTCTTGCTTTTAATAAACAAAAGTAACTCTAGAA
CAGTCAAGTCTTCGATAATTTTTTTAGTCACAGGGTCCGTCTAAAGTTTCTCTTTATTTG
GAATAATAGAAAAGAAAGAAAAAAACGTAGTATAAAAGGA
Chr coordinates Chr XIV from 117349-118809
w3c xhtml validator w3c css validator