Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PRM1
Systematic Name YNL279W
Strain S288c
Description Pheromone-regulated multispanning membrane protein involved in membrane fusion during mating; predicted to have 5 transmembrane segments and a coiled coil domain; localizes to the shmoo tip; regulated by Ste12p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PRM1 YNL279W
GGCAACATAGCAGTACGTCGCCAAAAAGAACGAAAACAAAATAGATATTATGCATAAACT
AACGTGATTTTCATACAGATATTGCAATTCAGGCAATTGTCCATCAGTCAATTTCCATCT
GATAGCCAAAACTAAGACCAAAGTTGTAGACATGGCAATTCCATTGATCTTATACGAAAG
CTTCGAACCATCCCTTAACTGAACACCCTTCATGACTCTGCCCGGTAAAATGACGTCCAA
AACTGCCAGTATTCCATACCACAGGCAATAGACAGTCCATAATTCACGATTGCCCAGATA
GTAGCGCAATGGCTTGATACCGTTCCAAAGCTCAACTATATCGAAATTCTGGAAAAATCC
CTTAATAAAATAATCGGGCCTTATCATTTGATTCAAGATGATAGTGAAAACAGGCAGCCC
TATGCTGATGCCTAAGGCACCAATCAGCCCACCAAATTCAAACTCTGTAGTTCTGGGATT
CAAAGCTGATACCATCCTTTTATTCTCTACACCGAATTTGTCTTTACTCCTATGCTGTTT
ACAAGGTCTATCTGATAAGCAATTGCGCAAGAAAATAGTAGAATGAAAACTGATTATTAA
AAACAAACGTAAACTCAAGCCTCACTTGATGCTCAGACGGAGTACGTGAAAAACGTCCGT
TATGCAAAACCCTTTATATGCACAACCTTCACACAATGCAAATTTCCGATGATGCCTACA
TACAAAAGAGCGAAAGGCGATATAAATTTTTTTCACGGGATTTTCGTTTAGGTGAAAATA
AAATGAACGACAGAGCATGCAGAGTCCGGGTAATACATATGTTTCAATACTGTTTCAATA
CTGTTTCAGAAGTGCGTCACATATTAATTTTAACTTATAACTGGCCTGTTGCTGGCAAGA
GGTATATATATATGACGAATGTGACCAACATAAGTCCTTAAGATAATCCCGAAATATTTG
GTTAGGATGATTCCCTTTCGAATTTGTGAACGTTGATGAT
Chr coordinates Chr XIV from 110917-112902
w3c xhtml validator w3c css validator