Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name HCH1
Systematic Name YNL281W
Strain S288c
Description Heat shock protein regulator that binds to Hsp90p and may stimulate ATPase activity; originally identified as a high-copy number suppressor of a HSP90 loss-of-function mutation; GFP-fusion protein localizes to the cytoplasm and nucleus
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HCH1 YNL281W
ATGCACATCCTATTGCCAGGGCGGATATTTGATGTTGTTCTCAGATATGTATTCCCTGAT
CTATACCGTTCTCATAGTTCAATTTTCTCTGATTTTCTCGTGCGGGCAATAAGTAAAAAA
TAGCATTTGCGTGCTTAAGTGAAATTTTTCAGATTATGAGTGATATAGAGATGAGGACTG
TAACAAGAAGGAAGGTGAGGAAATCAAGACGGTAAGTAGCATGTCCGGGTCGTTAAAATC
TCTAGACAAGAAAATAGCTAAAAGAAGGCAGGTGTATAAGCCCGTGCTAGACAATCCGTT
CACAAACGAAGCACATATGTGGCCGCGCGTGCATGATCAGCCATTGATTTGGCAGCTGCT
GCAATCCTCTATCATAAATAAGTTGATTCACATTCAATCGAAGGAGAACTACCCTTGGGA
GCTGTATACAGATTTCAATGAAATTGTGCAGTATTTGAGCGGCGCTCACGGAAACAGCGA
CCCAGTATGTCTATTTGTGTGCAATAAGGACCCTGATGTACCGCTTGTGCTCTTGCAGCA
AATCCCGCTATTATGCTATATGGCGCCCATGACGGTTAAACTGGTGCAGTTGCCCAAGAG
TGCCATGGATACCTTCAAGTCGGTTTCTAAATATGGAATGCTGCTGCTGCGGTGCGACGA
TAGGGTCGACAAGAAATTCGTATCGCAGATCCAGAAGAACGTTGATCTGCTTCAGTTTCC
CTGGTTAAATGCTATCAAGTATCGGCCCACATCTGTCAAGCTGTTGAAAACTACAGTGCC
AATTGTCTCGAAGAAGAGGCAAAAGTAGACAAAATTACCCGCGCAGGCCTATTTTTCTAG
AAGACAGAAGAAAAAAGTGGGCAGAGAAAGCGAGGAAAAAAAGAAATACATATGAAGAAG
AAAAAAGCTGAAATTTAAGCAAATACTTTTTGGACAAAATCATCAAACTACTACTAAAGT
TTGAAACGATCGGAAAGTTACAACACATTTACGATAAAAT
Chr coordinates Chr XIV from 108467-108928
w3c xhtml validator w3c css validator