Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PCL1
Systematic Name YNL289W
Alias HCS26
Strain S288c
Description Cyclin, interacts with cyclin-dependent kinase Pho85p; member of the Pcl1,2-like subfamily, involved in the regulation of polarized growth and morphogenesis and progression through the cell cycle; localizes to sites of polarized cell growth
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PCL1 YNL289W
TCAGTGACGACGTTATCTATGAATGCTGTGGGGCACCCAGACCAAGTGACTTAAAGGCAG
TATTGAAGTCGATACTGGAGGACGATTGGGGTACCGCCCACTACACACTTAATAAGGTAC
GCAGTGCCAAGGGTCTCGCGTTGATCGACCTAATCGAGGGCATAGTGAAGATACTGGAAG
ACTACGAACTTCAAAATGAGGAAACAAGAGTGCATTTGCTTACCAAACTGGCCGATATAG
AGTACTCGATATCCAAGGGTGGCAACGACCAGATTCAGGGCAGCGCGGTCATTGGCGCCA
TCAAGGCCAGCTTCGAGAACGAAACTGTTAAAGCCAACGTATAATCGACGCAAATATGTA
TAGATACAATATGTACAGAACAACTGCATTGTGCAATATAACAACATAACACAACGCCCA
GAACGAAATAAAAAAAATAAAAGAAATAGATGAAAGCATTTTCAATTTGCATACCGGAAA
CCGTAAATCAATTGGCGTCTAGCTAACAACTGAGAATGCGAATCGCCAAATTGTTACAGA
AAGTAGCATTCCGTTACGTGATCTGTACTTTAACCTCTTGGACGTAAAGAATGGCAGAAC
TCTGGCTCTAGTGTTCTGCGAATGCCAGATCGGGAAATATTTCCCAAAAGGGCAACAGCG
GCACGAACAAGAATTTCGTGTTAAAAATCGCGTCCGGCGCGAAATTTTTCGCGGAGGCAT
GCGACGCAAAAGCGACTCGAAATGTCGGGAGCCAAATGAGGCTACAAGGCTGTGGGCAGA
TTTTGGCGTTATTATGGAGAATAAAAGGAATGGTAGCTTCCATATAGCGATAGGAAAACA
TATATAAGGTCAATAGGCCTACATGGTAATGGGATTGATAAGCTTGTCCTTAACTCTTGT
GTCTTGGAATTACTATTGCGTACATCAGCAATCATCCATTGTCAAGAACAAAAACGATAA
CAAAAACAATCAATTATACAAATAACAGTAAAGTAATAAA
Chr coordinates Chr XIV from 87897-88736
w3c xhtml validator w3c css validator