Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name TOS6
Systematic Name YNL300W
Strain S288c
Description Glycosylphosphatidylinositol-dependent cell wall protein, expression is periodic and decreases in respone to ergosterol perturbation or upon entry into stationary phase; depletion increases resistance to lactic acid
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TOS6 YNL300W
TGGTGTACTGAGGTCTTTTTTAAAAGAAGCTCCAGCAAGAAAGAGTTTTGTGTGATGGCT
AATGAAGTGTCAATTGCATTTGGAAAGCAGCCTGATTTCTTGGGCGTGAATATGAAATTC
TTCTTTTGTTATTTTATAATATGAAGTATGAATGAAAACATAAAGCGCGCTGAGACAACG
ACTGTTCAATGTAAAATAAAGAAAATCTATCGTTCTCAAGACGTGGTCCCATTTTTTTTT
ACTTTGAATTTCGTCAGCAGTGTGACATGGTTAGAATGTAACCCCACATTTGCAAAGAGA
TTGTTACAGGAGCGTTCTAATTGTCCCGTACTGGTACATTCATAAGTGAAAAGAAAGCCA
TATCGGGCGCGCTGGTTTGTGAGCCACAGAAACCGGACAAGGCACTTCTTGAATACTTCC
CAAGGAAAGCGCCAAGGTTTACGGTTCTGATGGGAATGCAGGGGGGAATCTAGTCTTGAA
GTATCCTTATTCCTTAAAAAAAATATTGGACATCCTCTTCGAAATTAACAACGACGCCAA
AAACTTGTCTATGTTTTCAAAACCGCGCGTCACGAAAAAGCAGGAAGCACAAAGAAGTGA
CGCGAAAATGACGGTATATATAGCCATTAGCAGTCGCCAAAAGGTGAAGATCCTGACACG
AAATGTAGCAGAGTCACTACATTGATACTGATCTTGTACTTCCGAATAAGGCACCGCCAG
ATCAATTCTGTCTGATTTTGGCGTCTTCTGGTATAGTCTTGTAATGAACGGTGGTGATTC
TCGAGGAAAATAAAATTCGTGATAAATACATGCATGTGTATATATAAGGCGCTATATATG
GCCTTGAAACTTTGTTATTACGCCTACTCCATCTTTATTGGTACATATATCATTTAAAAG
AGTAGTCCATAGAAAACCAACTGCATTCCTTCCTTATCCCTGCCTTCGGCTAATTTTAAA
CCAACTTTTTACCTTCCTTTAATATCAATATCAAAATACA
Chr coordinates Chr XIV from 65744-66052
w3c xhtml validator w3c css validator