Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RPS19B
Systematic Name YNL302C
Alias eS19, RP55B, S16aB, S19B, S19e, YS16B
Strain S288c
Description Protein component of the small (40S) ribosomal subunit, required for assembly and maturation of pre-40 S particles; mutations in human RPS19 are associated with Diamond Blackfan anemia; nearly identical to Rps19Ap
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPS19B YNL302C
CAGTCTCCAGAATTGCTAGAGCTTTGAAGCAAGAAGGTGCTGCCAACAAGACTGTTGTCG
TTGTTGGTACCGTTACTGACGATGCCAGGATCTTCGAATTCCCAAAGACCACTGTTGCTG
CTTTGAGATTCACTGCTGGTGCCAGAGCCAAGATCGTTAAGGCTGGCGGTGAATGTATCA
CTTTAGATCAATTAGCTGTCAGAGCTCCTAAGGGTCAAAACACTTTGATCTTGAGAGGTC
CAAGAAACTCCAGAGAAGCGGTCAGACACTTCGGTATGGGTCCACACAAGGGTAAGGCTC
CAAGAATCTTGTCCACCGGTAGAAAGTTCGAAAGAGCTAGAGGTAGAAGAAGATCTAAGG
GTTTCAAGGTGTAATCTAGTATGGTTTGAAACCTTACAATTTTTCTTCTTTGTTCCTTTT
TCCTTGTTTCAGTGTATATTAGGTTGGGAAAGAGGGATTTTTCCATACCATATGACTGAC
TACAATATATACATGTATAATAACTTCATAATCTAAACCTATCAGTTCAGTATCAAGTCA
GCTATTCCGCCCTATGCATAAACCTACAAACTATCATTCACACACTTTTCCCATTTTTTT
TCAATACTACTTTACATCCGAACATTTTAGCAACCCACACCATATACCTTTGGTGCACTA
TTGATTTTCTTCCTGATGTCAGCTTTTTGTGCTTTGACAAAAAAATCGCGTCTACGTCCG
TCCGTTCTCCCTGAATAAATTAGGCGCGTTTGAGCCCAGCAGGACGGAGCTCTAGTGACA
AGCCCTGGTGTTTGGTGAGGTTTTGCACATTGCTGTTCTTTCTACTGTATTGAGATCTCC
AGTTTACGGCTCCCTGGGAGCCACCCGTAACGCGGTTGGTGTGCCCATTTCAATAAGCGA
ACATTAGTGAAGATACAATCGTTAAAATGGACTAATGAAATTTTAAAGTGGGATTTTTGT
GAATATTGACAACAAAGGTATAGAACCAAAGATAATAAAG
Chr coordinates Chr XIV from 62372-61958,62943-62924
w3c xhtml validator w3c css validator