Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MRPS18
Systematic Name YNL306W
Alias uS11m, YmS18
Strain S288c
Description Mitochondrial ribosomal protein of the small subunit; essential for viability, unlike most other mitoribosomal proteins
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MRPS18 YNL306W
TGTTTTAATGGCATTTCTAGCTTGTTTGTCACATAACGATTAATCTCGATTTGTAGAGTT
TCTGGTAAGCATTCCATGGCAAGGTGTTGATAAACTTTATTATCTTGCGGGGACAAATGA
GTAAAGAAATACTGCAATTTAACGATATTTGGATGGTCGGCAATCCTCAGAATCTGTAAT
TCCCTGGACTTGTACTCGGTATGAGCAGGGACTTTTTTAATTGCAAAGGGGCCCAACCAG
TTTTTCTTATCCTGGGTTAAATATGCTTGTACAACAGTCCCAAAGGCACCTCTACCGATT
TTCCTGTACTCTTTCACCAGCATCCGCCTCGTGTTGTTCGATTTATTCGAGGTTACATCG
TCTGCAATGAATTCAGATCCCCTTTGCAGAGGAACACCATTCTGCTCTTCCGTAGACATA
TGTACTAGAATGTGATGGAGTGGGGGTTTCGGAAAATAAAAAGAAAATTGAAAGATGAAG
CAAAGAACTCTGTAGTCTTGGGCTTAACTCCTATCAATAAACACGTTACGGGCCTGCCCA
CACTACTAACACGACACAATGGCACTCACTTGCGAAATCTATGTCGTTTTCCCTTGGAGG
TTACGCCTGCCCTCTTCCGCATATGAAGGTCGCTTTTTTCAGTGTTGTTTGTGGGTCACT
GAACTGTCATTACATACGAACTGAGTGGAAGCAAGAATGCTGCTTTCGAAAGCCACTACA
GCTACGTGTGATCATATAATTCCTGCATAATATGGCTGCATGCTTTTTAATGATAGCTTC
AATTATGATGATAATCACTGAGCTACTAGTATTCCATTATTCAGCCTAAGATTGGAACTT
TCTATAGCAGCGGAGAGTGTTTGTTTCGTACTTCGTGACTGTTTGGCATAATAACGATGA
ATTGGGAAAGAGGGAAGACAAAATGAGAGTAAATCAGGTGGAAAGCAGTGGTTCTTCTGA
AAAGAAAAAGTGACAGTGTGAACTGTTATAGTTACGTGTG
Chr coordinates Chr XIV from 58155-58808
w3c xhtml validator w3c css validator