Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name STB1
Systematic Name YNL309W
Strain S288c
Description Protein with role in regulation of MBF-specific transcription at Start; phosphorylated by Cln-Cdc28p kinases in vitro; unphosphorylated form binds Swi6p, which is required for Stb1p function; expression is cell-cycle regulated; STB1 has a paralog, YOL131W, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>STB1 YNL309W
TCTACCAAACAATTGCAACCGTTTCATGATTCGGTTGGTTTGAACGTTTGAAAATGCGGT
TCAACTTTTCATATCTAGCAGTGGCTCATCTTTATGTACTCTAGTCCTAAATCTTCTGCT
GGTTATCGCAAAAAAATATGTGATGTGCGGGTTTTTGGCAGTAATCATGACTCAGTCTCT
GGAAAAACGTGCTATTTAACGGTTATATATCTATCTATGTACATGCCTGTGCATGAGCTC
TTCATTCATTTCTGGGAAGGGTGAGGGAGCTGGGATGCATTTTCTGAGTTGTTCTTGGCA
TATTTTCCCAGGACGTCCTTTAGCGAATCTGGGATGTCTTCAAACTCCAAGTCGCCCACG
TCTTGGCTAACTTGTTCTCCGTTAGCTTTCATTAACTGTTCCACGGTAACATGATGATCA
TGGAATATTTTCAGATGGTCTGCTATCAAATGTCTCACTTTGCAGTGCGGACAAGAGATC
AAGACAGTACCTTTCTCGTACGCCTGCTTGGACATTGTGTGTGAAGATCGGGTGTTACAT
TTCTTGCAGGTGAAAGCTATCATCATCTTAGGCTTGTCTACCTTAAAAGACCCCAAATGA
ACCTTCTTATCGTCCTTTTTCACTTCATTATGTGCGATGATATTGGTATGCAACGCTGCT
GCGGGTAGAGTACGGCACACGTTGTAGCGTACGCGAGGCGCCCAACATCTGGCAAAGTAC
CTGGTAATTGGTATTTTACTTTGCAGTAGTGTTCTAGTCCTCGGAATCATGTTCAGTCTC
TTGATATTCCAGTTGCACCGGTGCTGCTTTAGTATCGCTGATCCCTTGAAGCCAACATGA
CGCTCTTTCACCTTTCCTCTCATAATTTTGATATCACGCGAAAATGCAAGAAAAAAAAAT
TACAATTATGAAGTGCAGAAGGAACCAAAAATATCATCGAAAGAAGGAGTACGTAGAGCG
TTACTATTTTCAATCAGTGTTCCCATTGTGCATACAAGAA
Chr coordinates Chr XIV from 52662-53924
w3c xhtml validator w3c css validator