Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name STB1
Systematic Name YNL309W
Strain S288c
Description Protein with role in regulation of MBF-specific transcription at Start; phosphorylated by Cln-Cdc28p kinases in vitro; unphosphorylated form binds Swi6p, which is required for Stb1p function; expression is cell-cycle regulated; STB1 has a paralog, YOL131W, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
Hide Seq
>STB1 YNL309W
ATGTCTCAACCCCAGATGTCCCCTGAAAAAGAGCAAGAATTGGCCTCCAAGATTTTGCAT
AGAGCTGAGTTGGCTCAGATGACGCGTCAATTAAAGCTTGGTTTAAGTAATGTCCCATCA
ACAAAACGAAAACAGGACTCTACAACAAAGAAAAGAAGCGGAGAGGATGCCGAAGATGTT
GATGAGGACCACAAAACTCTTTTGGAAGCCATATCGCCTGCGAAAAAGCCTCTCCACGAT
GATACAAATAAAATGACTGTTATATCGCCCGTAAAATTTGTAGAGAAGCCAAATACTCCC
CCAAGTTCACGCCAACGAAAAGCCGAAGACCGCTCACAGCAGATCAAGCCTAGGAAGGAG
GACACTCCATCTACTCCGAGGGCTTCTGCTACACCTATAATCTTACCACACGCTTCGTCA
CACTACCAGCGCCCCCATGATAAGAATTTCATGACGCCAAAACGTAATAATAACAACAGC
AGTAACCATAGCAATAACAATAATAATATCAAGAAGAAGGCAGCAGGCTCTAAGGATGCT
CCACAGGACAGCGACAACACTGCGGGCGCTGATCTCTTAATGTATTTAGCCACAAGTCCA
TATAATAAGTCATCACATCATGGAACACCGATGGCCGTAAGGATGCCCACTACTCCACGC
TCTTATCATTACGCGTCGCAATTGAGTTTGAACGGTAATACAGCAAGCACATCAAACGAT
GCAGTAAGATTCTCTCATATCAAACCTTCAGCGTCTTCTCCGCAGTCCACTTTCAAATCT
AATCTGTTACCGAATTTTCCGGACGAATCTCTCATGGATTCTCCATCACTATACTTGAGC
AATAATAACGGTAGTGTCCAGGCGACACTATCGCCACAGCAGAGAAGAAAGCCCACCACA
AACACATTGCATCCACCTAGTAACGTACCTACCACGCCTTCAAGAGAATTGAACGGTACC
AATTTTAACTTACTCAGGACGCCCAACTTCAACATGGGAGACTATCTGCATAATCTTTTC
AGCCCTTCACCAAGGGTCCCCGCCCAGCAGGGAGCGTCAAACACGTCAGCTTCAATTCCT
TCTGTTCCAGCGATGGTGCCCGGATCATCTTCCAACACTTCTGCGATAGCAACAGCTGCT
ATATCAAGCCACACCACAAACAATTTTCTAGATATGAACGCAAACGGGATCCCGCTCATT
GTAGGACCCGGCACCGACCGTATAGGCGAAGGGGAGTCCATTGATGACAAACTCACTGAT
TGA
Promoter Sequence
Download FASTA
>STB1 YNL309W
TCTACCAAACAATTGCAACCGTTTCATGATTCGGTTGGTTTGAACGTTTGAAAATGCGGT
TCAACTTTTCATATCTAGCAGTGGCTCATCTTTATGTACTCTAGTCCTAAATCTTCTGCT
GGTTATCGCAAAAAAATATGTGATGTGCGGGTTTTTGGCAGTAATCATGACTCAGTCTCT
GGAAAAACGTGCTATTTAACGGTTATATATCTATCTATGTACATGCCTGTGCATGAGCTC
TTCATTCATTTCTGGGAAGGGTGAGGGAGCTGGGATGCATTTTCTGAGTTGTTCTTGGCA
TATTTTCCCAGGACGTCCTTTAGCGAATCTGGGATGTCTTCAAACTCCAAGTCGCCCACG
TCTTGGCTAACTTGTTCTCCGTTAGCTTTCATTAACTGTTCCACGGTAACATGATGATCA
TGGAATATTTTCAGATGGTCTGCTATCAAATGTCTCACTTTGCAGTGCGGACAAGAGATC
AAGACAGTACCTTTCTCGTACGCCTGCTTGGACATTGTGTGTGAAGATCGGGTGTTACAT
TTCTTGCAGGTGAAAGCTATCATCATCTTAGGCTTGTCTACCTTAAAAGACCCCAAATGA
ACCTTCTTATCGTCCTTTTTCACTTCATTATGTGCGATGATATTGGTATGCAACGCTGCT
GCGGGTAGAGTACGGCACACGTTGTAGCGTACGCGAGGCGCCCAACATCTGGCAAAGTAC
CTGGTAATTGGTATTTTACTTTGCAGTAGTGTTCTAGTCCTCGGAATCATGTTCAGTCTC
TTGATATTCCAGTTGCACCGGTGCTGCTTTAGTATCGCTGATCCCTTGAAGCCAACATGA
CGCTCTTTCACCTTTCCTCTCATAATTTTGATATCACGCGAAAATGCAAGAAAAAAAAAT
TACAATTATGAAGTGCAGAAGGAACCAAAAATATCATCGAAAGAAGGAGTACGTAGAGCG
TTACTATTTTCAATCAGTGTTCCCATTGTGCATACAAGAA
Chr coordinates Chr XIV from 52662-53924
w3c xhtml validator w3c css validator