Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name DAL82
Systematic Name YNL314W
Alias DURM
Strain S288c
Description Positive regulator of allophanate inducible genes; binds a dodecanucleotide sequence upstream of all genes that are induced by allophanate; contains an UISALL DNA-binding, a transcriptional activation, and a coiled-coil domain
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>DAL82 YNL314W
ACCATAAAACCTTTGCACGTTTAGCAATAACAGCTGTGCATCCTGTACATTCACGTTTGT
ATCCGGTTCAACATGGCCATTCATAAAAACAATTCCCTTATCCTTGACCAAATCAGAATG
GAACTGCAAGGTAGTATGTGGCCTTGCAAATTCCTGGTGTAGTTTGTATTCTGCTAGGGA
AGTCATCATACAATGTGTTGTTTGGGGTCCGACAAACTGCCATTGGATGTAGTGTAGTTC
CATTCCCTGTTCTTCGTTCGGTTTTGCATCCTCAGATTGAACTTGTCTAGGAAGTGGCAA
CACGAATATAGGGTTATTCCTGGCATTTGCCATCATCTTATCATAAACGGAGACAGGAAT
CACAGCGCATAATGTATTATCTTTTTGTGCCCATCTTGCTCTCCAAAGAAACTCTACTTC
CTGTTTCGATAAGTCCTTCAGTTTTCCAACATCCAAAAAAGAGTCCAATGTTTTGAAGGG
AACTTTAGGAGCACTTGGATCGAGAGGACTTCTTGATTTCGTCATCAAATGCTTGGAGTT
GTTATTTTCCATTTGAGTTTTTTGTTGGTAATCCTCTAGTTCTTTCAGGGGGTCGATTTT
ATTAAATTCCCGCTTCTTAGACTCTATAGTCTCTTTCAAATGATTTTTCAACTCTTCTAT
GCTGTTAAAACCTTGTTTTTGAGCCTCTTCCAAAAGTTTCTTTCTATACTTCTGCTCTGG
GCTGGAAGAATAAAAACGAAAAACAGGAACTGTTCCAATTGCCTTGTTAAAAATGGGCGA
CAGCTGATTAGAAATATGGATTCTAGTGCCGATTTTTCTGGTTAGTCTCCACATAGTTAT
TCTTAAATCTCTTTTGTTCTCTATTTTCAAGTCTTGATAAGTTCTTCACATCCTTCGATT
ACGGCGTCAAAATAAGCGTTATTTCCATTCGGGTGAGTTGAACCATTGATAACAACATGG
TTTAACGATACTTTGAAAGGTTTAGGCGGAGCCAACCATA
Chr coordinates Chr XIV from 44447-45214
w3c xhtml validator w3c css validator