Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name EGT2
Systematic Name YNL327W
Strain S288c
Description Glycosylphosphatidylinositol (GPI)-anchored cell wall endoglucanase required for proper cell separation after cytokinesis, expression is activated by Swi5p and tightly regulated in a cell cycle-dependent manner
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>EGT2 YNL327W
CCTCCCTGGTACTGGTTTAATCTATTTTTCAGTTCTTCGTCTATCAGTGAGCTTTTGAAC
TTAAGTGCATCGCGGTAGCCCGCCGTCGGGTTTTCTATGCGAATGTTATTTAGTTTTGCA
ATAGTTAAAGGGGACAGGGTCTTGTAGACGGTCCATGCATTGAGACCAGACTTGACACTT
AGAGCAACCATTGTCACGCCCAAACCAATTATTATAGGCAAAACCATGCTGGAATATCCT
ATTCTTTGTGGCTATACTGTGTATTGAGTGGATCCTAGCAACGAATTCGTTTGTTGTTAT
TTTTTTCTAGATTGTATCTCCGTTTCCGAAATTGTTATTCACAATGAGCGTTTACCTCTT
GCAATAACAATAATCAGAGAATAAGCTACAAGACGAAAAATGACGTTGAGCGTGGCAGTA
ATGCCATAACGAAGATCAATAGTGTATGGGATGTTGGATATGTCGTTTCCCTGCCAAAGA
AAAAGAAACACAAAAAAGAAAAAGCAAAAAAAAACAGTGCTAAGGATTTGATATTAAACG
AAGTCCCACCATGGAGGATCATATCCCAATAAATTTATGCATAGAATGGTACCATTCACA
ACTAATATAGCCTCTGCTGGTTCCTTTAGTAACCTCTTTAGTAACCTCTTTAGTGAAATG
GTTCTTGCTGGCTCTATTATTTTCCTAATTCGGACGCGCTGGCTCCGCGCCGTGAGGAAA
AACAGCAGGCTGACAAGGGACTAATTTACTGACACTTTCGGCTGACACTTCCGAAAAGGT
ACTCAAGCTTTTATGAGTAAGATGCTGGTTTGATGCTAAGAATACGATTTAGTACTTCCT
TTTTAATGTGGCTTGTTTTTTTTTTATTCGTCCATAACAGTACAAATATAAAAGCAGAAT
ACATTCTTGCCGACCTAAAACTTGTGTCCTTAGACTCAAACTTTCTGATGGTTTTCTTTC
AGTAGAATCAACATAAACAAGCATAATATAAAACACTACA
Chr coordinates Chr XIV from 24048-27173
w3c xhtml validator w3c css validator