Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name COS1
Systematic Name YNL336W
Strain S288c
Description Protein of unknown function, member of the DUP380 subfamily of conserved, often subtelomerically-encoded proteins
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>COS1 YNL336W
TTTATATACACTTATGCCAATATTACAAAAAAATCACCACTAAAATCACCTAAACATAAA
AATATTCTATTCTTCAACCATAATACATAAACACACTCAATTGCGTATCAATACCACCAT
GACGTCATTAACTTAAATGTTCCTTAATACGTCATACCACTATGCTCTATTCCATATATT
GTAATATAACTGTACTCTATAGTCATACAGACGCTTTTACTTCACCCCATCTTCTCATAC
TATTGTCATAGAATCTCACACTGACGCATGATTAAAACGAATAATTTTTACTGTAAGGGC
TGCCATCCGCGCTCTATCCTTTTGTTTGCAATATTTATATACAGAATCTCAAAACAAGCG
GGAGAAGTGCTAATTACCCAGAGGTCATGCATAATCTGAGTACCACCGTACCTCTAGGTT
TTGCTTTGATCCGTTTTACAGTGACACCGAACATAAGGGGAAGCTATTGACATGGTATCG
AAAGGTTGTCCACATTGGGAAGTAACTTGGTTCTATGAATCTTCATGTCAGATACGTAGG
ACAGACTCTTCCTGTGTAAATATTTGTGACAGCTACGTCTATTTTCTACTAGATGTTTAC
ACAGTTTTGTCACAGGAAATCTACGCTTAAAATATGTATTTCATTCAAGCGGTAACCGCT
GTACGAGCAGTGACATTGCTGGTCGCACCTTAAATGTAAACCAACGTTACGGCACACCGT
GATGTACCCGCATTAAAGTTTTGTAAATTCGTTATTACGATTATCGAGTTGGCTAGATAG
AAAACCGGAAATGAAATGGATGCCCTTTTCGAATAGCTGAGTTTCTTTGCCTAAAATAGC
CCAATATTGTTTCCCTTTTTCTATCACGAGGTTACTGAGCCATTGCATGAACGCGCGCGC
CTCGGCGGCTTTTTTTTTCTGCTGTGCTGTATAAAAGCGAAAAGCCAGAAGTTACTATCT
CGAATAAAAAACCCCTCGAACTGCCATCTCACTACCGAAA
Chr coordinates Chr XIV from 8330-9475
w3c xhtml validator w3c css validator