Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YRF1-6
Systematic Name YNL339C
Alias YRF1
Strain S288c
Description Helicase encoded by the Y' element of subtelomeric regions, highly expressed in the mutants lacking the telomerase component TLC1; potentially phosphorylated by Cdc28p
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>YRF1-6 YNL339C
ATGGAAATTGAAAACGAACAGATTTGCACCTGCATAGCGCAGATTCTGCATCTTCTCAAT
AGCTTAATTATTACATTCTTAGATGATGATAAGACGGAAACTGGACAATCTTTTGTTTAT
ATTGATGGATTTCTTGTCAAAAAGCATAACAATCAACATACTATTGTTAATTTCGAAACT
TACAAAAATAAAATGAAAGTTTCCGATAGGCGTAAGTTTGAAAAAGCAAACTTTGACGAG
TTTGAGTCGGCTCTAAATAACAAAAACGACTTGGTACATTGTCCCTCAATAACTTTATTT
GAATCGATCCCCACGGAAGTGCGGTCATTCTACGAAGACGAAAAGTCTGGTCTAATCAAA
GTGGTAAAATTCAGAACTGGTGCAATGGATAGGAAAAGGTCTTTTGAAAAAATTGTCGTT
TCCGTCATGGTCGGGAAAAATGTACAAAAGTTCCTGACGTTTGTTGAAGACGAACCAGAT
TTCCAGGGCGGACCAATCCCTTCAAAGTATCTTATTCCCAAGAAAATCAACTTGATGGTC
TACACGTTGTTTCAAGTGCATACTTTGAAATTCAATAGAAAGGATTACGATACCCTTTCT
CTTTTTTACCTCAACAGAGGATACTATAATGAGTTGAGTTTCCGTGTCCTGGAACGTTGT
TACGAAATAGCGAGTGCCAGGCCGAACGACAGCTCTACGATGCGTACTTTCACTGACTTT
GTTTCTGGCACACCTATTGTAAGGGGTCTTCAGAAAAGCACCATAAGGAAATATGGATAC
AATTTGGCACCCTACATGTTTTTGTTACTACACGTAGATGAGCTATCGATTTTTTCTGCA
TACCAAGCAAGTTTACCTGGCGAAAAGAAAGTCGACACAGAGCGGCTGAAGCGTGATCTA
TGCCCACGTAAACCCACTGAGATAAAGTACTTTTCACAGATATGTAACGATATGATGAAC
AAAAAGGACCGATTGGGTGATATTTTGCATATTATCTTGCGAGCATGTGCGCTCAATTTC
GGGGCGGGTCCCCGTGGTGGCGCTGGTGACGAAGAGGATCGATCCATTACGAATGAAGAA
CCCATTATTCCCTCTGTGGACGAGCATGGCTTGAAAGTATGTAAGTTGCGCAGTCCTAAC
ACTCCACGAAGACTCAGAAAAACACTAGATGCCGTGAAAGCTTTATTGGTGTCGTCTTGT
GCTTGTACCGCAAGGGATTTAGATATATTTGATGACAACAACGGCGTTGCGATGTGGAAA
TGGATCAAAATTCTGTACCACGAAGTAGCGCAGGAAACCGCGCTGAAGGACTCTTATAGA
ATAACTTTGGTACCTTCTTCTGATGGTGTATCAGTATGTGGAAAACTGTTTAATCGCGAG
TATGTCCGCGGCTTTTACTTTGCATGCAAGGCTCAGTTTGATAACCTTTGGGAAGAATTG
AACGACTGCTTTTATATGCCTACAGTGGTTGATATTGCCAGCCTCATTTTGCGTAATCGA
GAAGTTTTGTTCAGAGAGCCAAAGCGAGGAATTGACGAGTATCTGGAGAACGATTCTTTC
CTTCAAATGATACCTGTTAAATATCGTGAAATTGTGCTGCCCAAGTTGAGAAGAGATACT
AACAAAATGACCGCGGCTCTTAAAAATAAAGTCACTGTTGCAATTGACGAGCTTACGGTG
CCACTTATGTGGATGATCCATTTTGCCGTAGGATACCCTTACCGTTATCCAGAGCTTCAG
CTACTCGCTTTTGCCGGTCCTCAGCGCAACGTATACGTCGATGATACAACAAGACGCATC
CAACTGTACACTGATTACAACAAGAACGGTTCATCGGAGCCTCGACTTAAGACGCTTGAC
GGACTCACTTCAGATTACGTGTTTTATTTTGTCACTGTGCTAAGGCAAATGCAAATATGT
GCGCTTGGTAACAGTTATGACGCTTTTAATCATGATCCTTGGATGGATGTGGTGGGATTT
GAGGATCCAGATCAAGTAACAAATCGAGACATTTCGAGGATAGTTTTGTATTCCTACATG
TTTCTGAATACCGCGAAGGGCTGTCTGGTTGAATACGCAACTTTTCGGCAGTACATGAGG
GAACTTCCGAAGAATGCACCTCAGAAGCTGAATTTTCGGGAGATGCGTCAGGGGTTGATT
GCCCTAGGACGGCACTGCGTAGGTAGCAGATTTGAAACAGATTTGTACGAGTCGGCGACG
AGTGAACTCATGGCCAATCATTCCGTTCAAACAGGGCGAAATATTTACGGTGTGGATTCC
TTTTCGTTAACTAGTGTCAGTGGGACGACCGCCACTTTATTGCAGGAACGAGCTTCCGAG
CGCTGGATTCAATGGTTAGGCCTTGAAAGCGACTACCATTGTTCATTCTCTAGTACTCGG
AATGCGGAAGACGTAGTGGCAGGTGAGGCGGCGAGTTCAGATCATCATCAAAAAATTTCA
AGAGTAACGCGAAAAAGGCCCCGAGAGCCCAAGAGTACAAACGATATCCTCGTCGCAGGC
CAGAAACTCTTTGGCAGCTCCTTTGAATTCAGGGACTTGCATCAGTTGCGCTTATGTCAT
GAAATATACATGGCAGACACACCCTCTGTGGCAGTACAGGCCCCACCGGGCTATGGTAAG
ACGGAGTTATTTCATCTCCCCTTGATAGCACTGGCGTCTAAGGGCGACGTGAAATATGTG
TCGTTTCTGTTTGTACCGTACACAGTGTTGCTTGCTAATTGCATGATCAGGTTGAGCCGA
TGCGGTTGCTTGAATGTGGCCCCTGTAAGAAACTTTATTGAAGAAGGTTGCGATGGCGTT
ACTGATTTATACGTGGGGATCTACGATGATCTTGCTAGCACTAATTTCACAGACAGGATA
GCTGCGTGGGAGAATATTGTTGAGTGCACCTTTAGGACCAACAACGTAAAATTGGGTTAC
CTCATTGTAGATGAGTTTCACAACTTTGAAACGGAGGTCTACCGGCAGTCGCAATTTGGG
GGCATAACTAACCTTGATTTTGACGCTTTTGAGAAAGCAATCTTTTTGAGCGGCACAGCA
CCTGAGGCTGTAGCTGATGCTGCGTTGCAGCGTATTGGGCTTACGGGACTGGCCAAGAAG
TCGATGGACATCAACGAGCTCAAACGGTCGGAAGATCTCAGCAGAGGTCTATCCAGCTAT
CCAACACGGATGTTTAATCTAATCAAGGAGAAATCCGAGGTGCCTTTAGGGCATGTTCAT
AAAATTTGGAAGAAAGTGGAATCACAGCCCGAAGAAGCACTGAAGCTTCTTTTAGCCCTC
TTTGAAATTGAACCAGAGTCGAAGGCCATTGTAGTTGCAAGCACAACCAACGAAGTGGAA
GAATTGGCCTGCTCTTGGAGAAAGTATTTTAGGGTGGTATGGATACACGGGAAGCTGGGT
GCTGCAGAAAAGGTGTCTCGCACAAAGGAGTTTGTCACTGACGGTAGCATGCGAGTTCTC
ATCGGAACGAAATTAGTGACTGAAGGAATTGACATTAAGCAATTGATGATGGTGATCATG
CTTGATAATAGACTTAATATTATTGAGCTCATTCAAGGCGTAGGGAGACTAAGAGATGGG
GGCCTCTGTTATCTATTATCTAGAAAAAACAGTTGGGCGGCAAGGAATCGTAAGGGTGAA
TTACCACCGATTAAGGAAGGCTGTATAACCGAACAGGTACGCGAGTTCTATGGACTTGAA
TCAAAGAAAGGAAAAAAGGGCCAGCATGTTGGATGCTGTGGCTCCAGGACAGACCTGTCT
GCTGACACAGTGGAACTGATAGAAAGAATGGACAGATTGGCTGAAAAACAGGCGACAGCT
TCCATGTCGATCGTTGCGTTACCGTCTAGCTTCCAGGAGAGCAATAGCAGTGACAGGTGC
AGAAAGTATTGCAGCAGTGATGAGGACAGCGACACGTGCATTCATGGTAGTGCTAATGCC
AGTACCAATGCGACTACCAACTCCAGCACTAATGCTACTACCACTGCCAGCACCAACGTC
AGGACTAGTGCTACTACCACTGCCAGCATCAACGTCAGGACTAGTGCGACTACCACTGAA
AGTACCAACTCCAGCACTAATGCTACTACCACTGCCAGCACCAACGTCAGGACTAGTGCT
ACTACCACTGCCAGCATCAACGTCAGGACTAGTGCGACTACCACTGAAAGTACCAACTCC
AACACTAGTGCTACTACCACCGAAAGTACCGACTCCAACACTAGTGCTACTACCACCGAA
AGTACCGACTCCAACACTAGTGCTACTACCACTGCTAGCACCAACTCCAGCACTAATGCC
ACTACCACTGCTAGCACCAACTCCAGCACTAATGCCACTACCACTGAAAGTACCAACGCT
AGTGCCAAGGAGGACGCCAATAAAGATGGCAATGCTGAGGATAATAGATTCCATCCAGTC
ACCGACATTAACAAAGAGTCGTATAAGCGGAAAGGGAGTCAAATGGTTTTGCTAGAGAGA
AAGAAACTGAAAGCACAATTTCCCAATACTTCCGAGAATATGAATGTCTTACAGTTTCTT
GGATTTCGGTCTGACGAAATTAAACATCTTTTCCTCTATGGTATTGACGTATACTTCTGC
CCAGAGGGAGTATTCACACAATACGGATTATGCAAGGGCTGTCAAAAGATGTTCGAGCTC
TGTGTCTGTTGGGCTGGCCAGAAAGTATCGTATCGGAGGATGGCTTGGGAAGCACTAGCT
GTGGAGAGAATGCTGCGAAATGACGAGGAATACAAAGAATACTTGGAAGACATCGAGCCA
TATCATGGGGACCCTGTAGGGTATTTGAAATTTTTTAGCGTAAAAAGGGGAGAGATCTAC
TCTCAGATACAGAGAAATTATGCTTGGTACCTGGCCATTACTAGAAGAAGAGAAACAATT
AGTGTATTGGATTCGACAAGAGGCAAGCAAGGGAGCCAAGTTTTCCGCATGTCTGGAAGG
CAGATCAAAGAGTTGTATTATAAAGTATGGAGCAACTTGCGTGAATCGAAGACAGAGGTG
CTGCAGTACTTTTTGAACTGGGACGAAAAAAAGTGCCGGGAAGAATGGGAGGCAAAAGAC
GATACGGTCTTTGTGGAAGCGCTCGAGAAAGTTGGAGTTTTTCAGCGTTTGCGTTCCATG
ACGAGCGCTGGACTGCAGGGTCCGCAGTACGTCAAGCTGCAGTTTAGCAGGCATCATCGA
CAGTTGAGGAGCAGATATGAATTAAGTCTAGGAATGCACTTGCGAGATCAGCTTGCGCTG
GGAGTTACCCCATCTAAAGTGCCGCATTGGACGGCATTCCTGTCGATGCTGATAGGGCTG
TTCTGCAATAAAACATTTCGGCAGAAACTGGAATATCTTTTGGAGCAGATTTCGGAGGTG
TGGTTGTTACCACATTGGCTTGATTTGGCAAACGTTGAAGTTCTCGCTGCAGATAACACG
AGGGTACCGCTGTACATGCTGATGGTAGCGGTTCACAAAGAGCTGGATAGCGATGATGTT
CCAGACGGTAGATTTGATATATTATTATGTAGAGATTCGAGCAGAGAAGTTGGAGAGTGA
Promoter Sequence
Download FASTA
>YRF1-6 YNL339C
GGCAGGGTAAGTTGAGATGGTATATACTGTAGCATCCGTGTACGTATGACCGATCAGAAT
ACAAGTGAAGGTGAGTATGGCATGTGGTAGTGGGATTAGAGTGGTAGGGTAAGTATATGT
GTATTATTTACGATTATTTGTTAACGTTTCAATATGGAGGGTAGAACAACAGTATAGTGA
GTAGCAGATGGTCGATGGTAGGGTAATGGTAGTAGAGTTGGATTTGGGTAATTGGAGGGT
AACGGTTATGATGGGCGGTGGATGGTAGTAGTAAGTAGAGTGATGGATGGTGGTTGGGAG
TGGTATGGTTGAGTGGGGCAGGGTAACGAGTGGGGAGGTAGGGTAATGGAGGGTAAGTTG
AGAGACACGTTCATCAGGGTTAGAATAGGGTAGGGTTAGGGTTGTGATGGGTGTGGGTGT
GGGTGTGTGGGTGTGGGTGTGGTGTGGGTGTGTGGGTGTGGTGTGTGGGTGTGGGTGTGG
GTATATATATGTCACTGTATTGCATGCTGGATGGTGTTAGACAAGGCCGTAGGGACATAT
AGCATCTAGGAAGTAACCTTGTACGAAAATAGGCAATATTTCCTGTTTAGGCGATTGTGA
CGCAGATTTTAGTCCAACGATCTAGCGTCAAGGAATTTTTTTATAGTGGGACATTGCACC
AAGGAAGTAACTTGATACGTCGTGGGTGAATGGGTCTGTTTTCTTATTCGGCGGGGTAAT
ACATTTTTGGGGGAAGTTTGTCTGTCTGACGCGCCATATGTAGGTACGCCAAAAAGGGCT
CCTCTACTTCGAAGCGCGAGGTCGTATACCTAATAAGGAAATGTAATTTATAACTTTCTA
TTATATTGGTCTTTTCGAGAGCGGAAGAAGTTGTAGGCTAAGCGCAGGCTAAGCGTAGGT
CCATATTTAAAGTATCCAAGAGAATATCCACGAAGCGGCTGAGCAACGAACAGAATCCTG
GTTCTCCTCGACTAAGCAGATAGTTAAGATACTGTGCACC
Chr coordinates Chr XIV from 5931-371,6098-6080
w3c xhtml validator w3c css validator