Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CIT1
Systematic Name YNR001C
Alias CS1, LYS6
Strain S288c
Description Mitochondrial citrate synthase; catalyzes condensation of acetyl coenzyme A and oxaloacetate to form citrate, which is the first and rate-limiting step of the TCA cycle; transcription subject to glucose repression; CIT1 has a paralog, CIT2, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CIT1 YNR001C
TAATATTATAGCCTTTTTCAACAATGGAATCCCAACAATTATCTCAAAAATCACCTAAGC
CTCACATGCATGTTTTACGTTGTGGTTGATGATCTATTGATGTTGAGGTACCATATTTTG
AAATTCATTAAAACAACTTCTACCGGGCGTGTGGTCTAGAGGTATGATTCTCGCTTAGGG
TGCGGGAGGTCCCGGGTTCGAGTCCCGGCTCGCCCCCATTGATTTATTTTTATCAAATTT
TTTAATATTGCATATCTTTAGTGGGCAAAAAATTTTTCCCTGGGCAAAAATATAAGAGAG
CTCATCTTATTGTTGTCAGCCCAATGATTCCCTTGTCAAATTGAATTTTCGGATTTACTT
GTTCAGGTACCCGCGTTAAGGGGCTGCCGCGCCTGTCACTCTAAGAAAAAAGGAGCCATC
AAAAACCATTCAGCATTAACTAAAAACGCGGGTAGAGATTACTACATATTCCAACAAGAC
CTTCGCAGGAAAGTATACCTAAACTAATTAAAGAAATCTCCGAAGTTCGCATTTCATTGA
ACGGCTCAATTAATCTTTGTAAATATGAGCGTTTTTACGTTCACATTGCCTTTTTTTTTA
TGTATTTACCTTGCATTTTTGTGCTAAAAGGCGTCACGTTTTTTTCCGCCGCAGCCGCCC
GGAAATGAAAAGTATGACCCCCGCTAGACCAAAAATACTTTTGTGTTATTGGAGGATCGC
AATCCCTTTGGAGCTTTTCCGATACTATCGACTTATCCGACCTCTTGTTGTTTGAAAATG
TCAATTGATATCCATCCATTATATAAATGCTCAAAACTTGCAGCAACTATTCTTTACCCT
TCCCCTGTTATGGATTGCTAGTCTTAAGGGGGAAATTTGCTGTTTACTAAAATACAAACC
AGGTTTGTTTTGGCTTTTATTTGCATTTAAGTAATTACAATTACAACCATTAAAAAGAAA
ATAAGGCAAAACATATAGCAATATAATACTATTTACGAAG
Chr coordinates Chr XIV from 631061-629622
w3c xhtml validator w3c css validator