Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ATO2
Systematic Name YNR002C
Alias FUN34
Strain S288c
Description Putative transmembrane protein involved in export of ammonia, a starvation signal that promotes cell death in aging colonies; phosphorylated in mitochondria; member of the TC 9.B.33 YaaH family; homolog of Ady2p and Y. lipolytica Gpr1p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ATO2 YNR002C
TACATGTTGTACAGCTTACAACCCTCTGTGGACATCACAGGAGGTCCATGGTTCACAGAT
GGAGAGCTGGATATAGAATTTATCAATAGTTTATTGACTATTGTTTGGAGGTTCATATCA
GAGAACACCTTCCCTAATGGCTTCAAGAATTTCGAAAATGGACCCAAAAAAAACGTCTTT
TATGCTCCAAACGTAAAAAATTACTCTACCACACAAGAAATTTTGGAATTTATTACAGCG
GCACAAGTGGCCAATGTCGAGTTAACCCCTTCAAATATCAGATCTTTGTGTGAAGTCTTA
GTGTACGACGACAAGCTGGAAAAAGTCACGCATGACTGCTATAGAGTGACCTTAGAGAGC
ATTCTACAAATGAACCAAGGTGAGGGCGAGCCGGAGGCAGGTAATAAGGCTTTGGAGGAT
GAAGAAGAATTTTCCATCTTTAACTACTTCAAGATGTTTCCGGCTTCAAAACACGACAAG
GAAGTGGTCTATTTCGATGAATGGACAATTTGAAGTTCTTGACTACCCCTATCTCACACT
AGTACGTAATTCAATGTATCATTCGTATTGTAAGTAGATAGAGACGCAATACAGGAAAGC
TGACCTTCCTTCCAATCACCACGGCTGAAATGCTTTGTTGACCAATTACGGACGCTTAAG
AGCGGACGCGGCTGGAACGGCTCCATCCTAAATCGGCGGAGGGAGAACTCCGATACCAGC
CGACATGGCAATAATAGTGACAGTAGATGCTACCAGCCCCGCAATAATTTCACAGTAGAT
CATCAACAGTCTCCTCATTTCTGGAAATGATCAGCAACTTCGACGGATTTAACTCTCAAG
CAGTTACGCACTCCGAGAACAGCCGTGATCATCTTTGAACAAGCAAAATATATAAAGCAG
GAGAACTGTCCTACCTAGAGCTAGAATAGCCATAACTAACTATGTAACATTCTACAGATC
AATCAAAAACAATCTTCAATCACAGAAAAAAATAAAAGGC
Chr coordinates Chr XIV from 633856-633008
w3c xhtml validator w3c css validator