Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name NRM1
Systematic Name YNR009W
Strain S288c
Description Transcriptional co-repressor of MBF (MCB binding factor)-regulated gene expression; Nrm1p associates stably with promoters via MBF to repress transcription upon exit from G1 phase
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>NRM1 YNR009W
CTTCAGAGGATGCATTGAATAACAACACTGACACATACGGCAATTTCATTCGATTTGAAA
GGAATACGAGCGATGCTTTCAACAAAAATTTGACAATGAAAGACGCCATTAACATGACAT
TATCGATATCACCTGAATGGCTCCAAAGAAGAGTACATGAGCAGTACTCGTTCGGCTATT
CCAAGAATGAAGAAGAGTTAAGAAAAAATGAGCTACACCACAAGCACTGGTCGAATCCAA
TGGAAGTACCACTTCCAGAAGCTCCCCACATGAAAATCTATTGTATATACGGGGTGAACA
ACCCAACTGAAAGGGCATATGTATATAAGGAAGAGGATGACTCCTCTGCTCTGAATTTGA
CCATCGACTACGAAAGCAAGCAACCTGTATTCCTCACCGAGGGGGACGGAACCGTTCCGC
TCGTGGCGCATTCAATGTGTCACAAATGGGCCCAGGGTGCTTCACCGTACAACCCTGCCG
GAATTAACGTTACTATTGTGGAAATGAAACACCAGCCAGATCGATTTGATATACGTGGTG
GAGCAAAAAGCGCCGAACACGTAGACATCCTCGGCAGCGCGGAGTTGAACGATTACATCT
TGAAAATTGCAAGCGGTAATGGCGATCTCGTCGAGCCACGCCAATTGTCTAATTTGAGCC
AGTGGGTTTCTCAGATGCCCTTCCCAATGTAAATGACCGACATTGACTCACTATCCATCC
GTGTATTATTTCAAAGAGCGAAAAGAAGGCGCGTCGCGTCGACGCGCCTTTTTAGGCTAG
AAAATAAACAGAAAACAAAAACAAAAACAAAAAAAGGCGAAAAAACAAACGAAAAAACAA
ACGACAGTAGATAGAGGAGAAGGTTTTTGACAGGTTTGTGTAATTGGTTATTTGCTTTTA
TAGATTATATATACACAAACTTAAAACACTGTTTTCTAAGTAGGCTGCGGAGAGGGCCAA
TTGCAGCAGCGACGTACGCATAGAGGAAAAACAACCGTTC
Chr coordinates Chr XIV from 642690-643439
w3c xhtml validator w3c css validator