Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CSE2
Systematic Name YNR010W
Alias MED9
Strain S288c
Description Subunit of the RNA polymerase II mediator complex; associates with core polymerase subunits to form the RNA polymerase II holoenzyme; component of the Middle domain of mediator; required for regulation of RNA polymerase II activity
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CSE2 YNR010W
AACAAACTGGCAATTGCCAATATTGCAGACGCTAGCGAGCCTAGAAACCATGGAGAAAAC
AACGTCGGGACTGTGTGTCTTCCCTCTATCAAGAGTTTGATGGTTAGTCCTGAAGTATAC
GAAAACACGAAGAGTCTTCCTGTTCCCCTAATGAGGAGCAGTGGCGGAGGTATGGCTTGT
GCCAGTAAGTCCTCATGCCAGGATGGTATTAGTACGAAAACAACGTCTAGAGATTACTCT
GAGCTTTCCAAGAAGTTGCAAATTCGTTTACAGTTCGCCTATTATAAATACAAGACTAAG
CAAACAGACAAAAATTTCACAGACTTGAAATCAAAGCATAGCATTACGAGGCCTTCCAAA
GTCGCGACTCACAGTAAATCAGAACCTTTAACTAGGAGAAGAAAATTAGTACTATCTCAG
GGTCATTATAAAACCCCTGCTAGGTCTAAGATCAAAACTCCATCTTCGATTTGCTCTCAC
GATAATACATCTTCCTTTACATCTTTCCGCGGTGTCAGCGAAAGCTCGAGCACTACCGCA
GATATGAACGTCGCAGATACCACCACACCAATACGCAACAACATAAACACAAAGCATTCA
AACAGTCATAATCGCACATTGTATCAGAGACAAGAAACACCTACAAGCATCAAAGCCGCT
AAGTCTTTAATTCATCTCTTTACAAGTAACCAATAATCCCACCCCCAATATTTCTATCTT
TCATTTTCATTCTCCTTCATTGTGTATATAATAATATTATTGTCTTCGTATATCTTCCAC
ATTACCTTTTCACTTCCGCTTTAGTTCTGTACGTATAATTAGATAGAATATCATATAAAA
CCTGATTTTATTAGTATCGATTGCAATTCTACTGCGGCCATTAACTGTAACCGAATTGAA
GAAAATAAAAGAAAAAAAGAGAACATGCATAAATGGGAAAAAGAAGGCGAAGCATACCAG
CATCTACCAGAGAGACACGAGCACTGAAAGTCGCCATAAA
Chr coordinates Chr XIV from 643744-644193
w3c xhtml validator w3c css validator