Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ACC1
Systematic Name YNR016C
Alias ABP2, FAS3, MTR7
Strain S288c
Description Acetyl-CoA carboxylase, biotin containing enzyme that catalyzes the carboxylation of acetyl-CoA to form malonyl-CoA; required for de novo biosynthesis of long-chain fatty acids
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ACC1 YNR016C
GCGCATGCATCGACGTCACAGTGAGCTCAGGCCGCATCACGGCCGTTACGCCCTCCAGAG
TCACCACGACTGCGACTAGTATCATCCGTCAAGAAGAACAAGAACAAGAACAAGAACAAG
AACAACAAACTCCGGGCACATCTCTCGGCTTCAGTCGCTTTCGCTCATTGCCTGTAGGTT
GGCCCGATATGCGTTGACGTTATCCAAAGGGGAATGCTTCATCTTGTTGAACAACGCCCA
ACAATTTCCACTGCCCACCGAATCGTTGCGCCCGTTAAAATCTTCACATGGCCCGGCCGC
GCGCGCGTTGTGCCAACAAGTCGCAGTCGAAATTCAACCGCTCATTGCCACTCTCTCTAC
TGCTTGGTGAACTAGGCTATACGCTCAATCAGCGCCAAGATATATAAGAAGAACAGCACT
CCCAGTCGTATTCTGGCACAGTATAGCCTAGCACAATCACTGTCACAATTGTTATCGGTT
CTACAATTGTTCTGCTCTCTTCAATTTTCCTTTCCTTATTCTACTCTTTTTATCCCTTTC
GTACAGTTTACCTGAAGATAAAAAACAACAAAGCCAATTCCCTAATTTGCAATCGCCATT
TGCATCTATATATATATATTTGTTGTGCCATTTTTTTATCCTCTGTGAGTGATCGGTGCA
TGTGTTTATAAAAGTTTATTCATTCTACTATACGAACTTTTCCCTCTGCCCTTCCCTCCC
GCTTCATCCTTATTTTTGGACAATAAACTAGAGAACAATTTGAACTTGAATTGGAATTCA
GATTCAGAGCAAGAGACAAGAAACTTCCCTTTTTCTTCTCCACATATTATTATTTATTCG
TGTATTTTCTTTTAACGATACGATACGATACGACACGATACGATACGACACGCTACTATA
CTATACAAATATAATAGTATAATAACCGATTCGTCTTCTAGCTTAATTTTTTTCCGTTCC
CGAAACAGCGCAGAAAATTAGAAAAAATCAAGTTTCTACC
Chr coordinates Chr XIV from 661374-654673
w3c xhtml validator w3c css validator