Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RCF2
Systematic Name YNR018W
Alias AIM38
Strain S288c
Description Putative protein of unknown function; non-tagged protein is detected in purified mitochondria; may interact with respiratory chain complex IV; null mutant is viable and displays reduced frequency of mitochondrial genome loss
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RCF2 YNR018W
GGTCTGCAGAATATTCCGCCCAATAGTCCCGGAAAATTGCAATTGAACACCGTCCTGAAT
CACATTACTAAGAGAGGTCCCTTCTTAGGTAATAATGCGGGGATTCTCGCGTTGAGCTAC
AATATCATCAATTCTACAATAGATGCACTAAGAGGCAAACATGACACCGCGGGCTCCATT
GGCGCTGGGGCCCTCACGGGCGCTTTGTTCAAGTCTTCAAAAGGTTTGAAACCCATGGGT
TATTCCTCGGCAATGGTGGCCGCTGCGTGCGCCGTCTGGTGTAGTGTCAAGAAAAGACTA
CTTGAAAAATGAGCAACACAAGAACCTACTCTCTCTCTCTCTTTCTCTCTCTCTCTCCCT
CTTCGCTTTTCCCCCATGCACTGATGGCGCTTGTATATAGCATTTGAAAAATAATAGTAC
GTAACGCAGAAAACAAACCAATGAAAGTAGAAACCCGGAGAAAAGATCTAAAAAAACAAA
AAAAAAAGATGGAAAGAGCGCATGTATGTGTAGATATGTACATATATACAACTACTTGTA
TGTTATTTGCCTTTTGTACTGTTAAGCTATTGTTTTCGATGGCCAATTAAAGTAAAACAA
ACCGCTCACTCTCGGGTATTTCCCGAAACTGTCAGAGCCGTCCCGGCCCACCGATTCGCC
CGGCAAGACCTGCTTGGAAGCAGCACAAAGCCCTGCGGCCTCTGTACACCTCACGCTAAA
TAGCTGCTAACGATCAACACCTGACCGAGATAACAGCAGCAAAGAACCCGCAAAAAACTG
CGCCGTCTAGGCCTCAACCCTTGCTTCCTACAACCAAACAATGGTAAAATATACAAAAAA
AAGAAAAGAATGCTCTTTCTTATTTCCCTTTTAACCTAACCATCTTTTGTTTTTTGTCGT
TTAACCTGGAAAGAATGTTCTATTATATAAACACTCTTTACTACGTCTTTAGCTTGAAAA
AACTCTTGACAAGTGCACCGATACTCACCAACATCGCACA
Chr coordinates Chr XIV from 664270-664944
w3c xhtml validator w3c css validator