Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ARE2
Systematic Name YNR019W
Alias SAT1
Strain S288c
Description Acyl-CoA:sterol acyltransferase, isozyme of Are1p; endoplasmic reticulum enzyme that contributes the major sterol esterification activity in the presence of oxygen
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ARE2 YNR019W
GCCCTTGCCGGATTTGCAATCTCTGCTATAATTTTCAAAGTCCTACCAAGAAGGTACCCA
AAATTCAAGCCTTCGACTCTAACATGGTCCATAAAAACCGCCCTTTGGATCACCCCTCCC
ACGGTCTTGACTGCTATATGTGCGGAGGAGGCCTCGAACAATTTCGACGCTACAATGTAC
GGATCCGGTTCCTCCTCGGAAGACGCACTAGATGAGCACAGAAGATGGAAGAGTTTGAGT
ACAAAGGACAAGTTTGTCGAAGGTCTATCTAATAACAAGTATAAGATCATCACCGGTGCC
TGGGCCGCTTCGCTGTATGGGTCGTGGGTAATCGTGAACAAAGACCCCATCATGACCAAA
GCTCAGAAGATCGTGCAGGCAAGAATGTACGCTCAATTCATTACCGTCGGGCTGCTGCTG
GCCTCCGTTGGTTTGAGCATGTACGAGAATAAGTTACATCCTAACAAACAAAAGGTCAAC
GAAATGCGCCGCTGGGAAAACGCACTGAGGGTCGCCGAAGAGGAAGAGAGACTCGAGAAA
GAGGGAAGAAGGACCGGCTACGTTTCTAACGAAGAAAGAATAAACTCCAAGATCTTCAAG
TCGTAAACCTCGTCGGTTTATCTGCCTCAACTTTATTTCCGCTCCTCGTCTTTTATAAAA
TTCCTTTCATCAATACATCTATATATTCGAATATATAGATAAACCAATACAAAAACATAC
TGAAATTTTTTGAAAACAACTAAAACTATTCATTGCAGTTACACGTGAATGCTAAACTTT
ATATCGCTCTTGTCGGTCCCGCGGAGTTAACATTTAACGGCTTCTCGCGCAATAACCGGA
AAAATTCCAACAGTTTCTTTGTAATATTATTAAGCCTTCTTTTTTCCCGGAATCTATAAG
AGGGGACGAAAATTAGCCGCTATTAATTCTGGTATTGCCACCTAGACAAGAAGTAAACAG
ACACATTACGTTAGCAAAAGCAACAATAACAAACACAACC
Chr coordinates Chr XIV from 665339-667267
w3c xhtml validator w3c css validator