Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YNR021W
Systematic Name YNR021W
Strain S288c
Description Putative protein of unknown function; green fluorescent protein (GFP)-fusion protein localizes to the endoplasmic reticulum; YNR021W is not an essential gene
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YNR021W YNR021W
CTATTATAGAATATTGTCATTTATTACATTGGTTCATCTGTAAATCTCATCAAACGGTCT
CGTATCGGCGAAGCAACTGTCCCAAACTTCATCTACAATTTTTGCTGCATGTTCTTTGCT
TTGGCAGTTGGGGTTCCCCGAAACACTAATTATTGCCCTCCTTCTAACACAATCTTGGTG
TCCCCTTGCCACATGGAATCCTGTCCTAAACCCTCTTCTCTTGAACTCTTCCCAAAACCT
GCATTCCCCACTTAACGAAGAGGCTCTGATTTCAGAACATGCATGATGCTTCAGATTTAA
CCAATCTATTTGCCATTTTAGATCATCGAAATAATGAATTAATTCATGCGAAAGCGTATC
CTCTAAATGCCACTTATCACGTAACCTGTTCTGGCACAATAGGATTCCCAATTCAGGATG
AAAGCCACCGCCCTTCCAGTCGGGACAGTAATCGCAGATGATCTTCGAATCGTCGAATTT
ACTGTCGCTACCCTTATTAAGTTTCGTAATAGCTTGTACCATAAAGCGAACTGTGGGAGA
GTATTTAAGCATCCAATCTCGATACTCATAACATTTCAGACATTCCTTTTTTAGTTCTCG
AGCTTTAGAGTCGTCTTCGTATCGAGTTTTCTCCTCCGGTGTCAAGCCTATACCAGTCTT
GTACTGCATGGTCCGTCTCCACCACTCAAACCCAGCATTATCCCCACTGCTATTCATATC
GTGCCAAAAAAAAAAAAAATTCGGTACTATCAGCTTTCCTTGGTTTTGGTTGTACAAATT
ATGCCTTACTCTTCTGATCATTTTGATATTAGAACTCTTATTTTTCTTATTTGTTCGCAT
CGTCATAAATGATAATTGGCGAAAACGCGCCAAAAAGTGAAAAAGTGAGAACTACTTGAA
AAAAAAAAGTTTGATATTATAGGTATTATTGCTCAAATAGGTACGATATTGTTGTAGGCA
TAAAAATTAGATTAGCAGAACCCTTTTCCATTTCATTAAC
Chr coordinates Chr XIV from 668377-669591
w3c xhtml validator w3c css validator