Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CPR8
Systematic Name YNR028W
Strain S288c
Description Peptidyl-prolyl cis-trans isomerase (cyclophilin), catalyzes the cis-trans isomerization of peptide bonds N-terminal to proline residues; similarity to Cpr4p suggests a potential role in the secretory pathway
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CPR8 YNR028W
ACTTAGTGGCTATTTACCCAATGTTCAAGCCCTGCAAAAGGTAGCAGGAATAGTGGGTCA
ATTATGTGAGGGGAGTGAAAACGTCAAGTGGATATTAGATCCTGTACTGGGCGATAATGG
AAGGCTGTACGTGGATCGAGAATGTGTTGCGGTATACCAAGACATTTTACAAAACTTCAA
AATTTTTTTGGCCACACCAAATCAGTTTGAAATGGAACTGTTGGTGGGGATGTCAATTCG
TACCTTAGACGACGCTAAGCAGGCATTTAAACTATTTCATAAAAAGTACCCTCGAGTAAG
CCGAATAGTTGTCACTAGTCTGGAATTATCTGAATTCCTGAGCAACGACACTTACGTAGT
AGCAGGGTTTGATTGCTCGGCCAGTGAAGAGATATTCTTCTATGAAATCCCCAAGATCAA
CGCAAAATTTAGTGGAAGTGGTGATTTAATCAGCGCCATGCTCACTGACTCGTTACTAGG
CGACCGCCGCTGCACACAGCTGTCATTAAGCGCATCCTTGGGCCAAGTGCTGTGGCTCGT
CACCAGTATCCTACAAAAAACGTATGATTTAAACATAGCTGAGCGGGGCCCACAAGATTC
CACGATAGATATCAAGGATTTAAAGCTGATTCAGTGTAGAGACATCCTAAAGCAAGATCT
CATACCCTCCATTGGCAAGCCAAAAACCATTAAAATATGATTCTTACGAAACGGTATGCT
CCTTCCTCATTGGGGTGCGGCTGCTGCAGGAACCTGCCTAAATAGGAAAATACATTCCTG
ATTTGGAAACTGTAGGCACACGACGCGTCCCTTTGGAGAAGATCGATCCTTCTTTGGGTC
TTTCAATTTGATTGGAAAAAAAATATTTAAAAAAATAGAAGAAAAATATAGAATATATAG
AATATATAGAATCAACTACTGCAGTAGATAAATAAAGAAGACTATTCATATTCAGTATCA
CAATTGAAAGATTATTACAATTTGTATACATTGGTTCCCA
Chr coordinates Chr XIV from 676177-677103
w3c xhtml validator w3c css validator