Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name DBP6
Systematic Name YNR038W
Strain S288c
Description Essential protein involved in ribosome biogenesis; putative ATP-dependent RNA helicase of the DEAD-box protein family; human homolog DDX51 complements yeast dbp6 mutant
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>DBP6 YNR038W
CGCAGAATTCGGCTTCTTGGGCTTTAAAACCATTACACGTAATACGACACCCTTCCGCTG
GGGACACTGATCCAGTTGTGGAGCTGTACTTATCTTCTTGCGTCTTGGAGGCCCGGAGCC
TCTTTTAATCTGATTCAATGTCGCTTGCATTGTCGTAGTGGAGGAAAACAATCTCTGCGC
CTGTCTCAAGGGCGTACACCATGTGTTGGACATAAACCTCGACAACATGGCTCTTGTTGG
CCTGCTTCAATTCTGGTGTACCTGTAAGTTCTCCGTCTTTTCCCTGGTTATATGCGTTTT
TTCTCCCCAAATCGTTTTGTCGCTCGGGTAAGACTGAAATGCTTTTAAAAGCACTATTAC
TGTTTATTATGCTATATATATATATATATACAGCCCGAGTCTGGCTTGATCTTATTTACA
TGATATATCATCTAGAAATCTATATACACTAGATCCCTCATTTGTTCTTGGTTTGAGTAT
AGCTGAAACGCTTCCTGGTAGGTGCGAACTCGCCCAGTTTGTGGCCCACCATATCTTCTG
ATATTTCAATAGGTACGTACTCCTTACCATTGTGTATTTGAAATTTCAGTCCCACGAACT
GAGGAAGGATGGTGGCGGCCCTTGCGTTTGTTCTTATTGGAGTGCCCTTAGTCATGGCCT
CCCTTATGGGTAATGGCACGATGTTGGGGCCCTTCCATACGGACCGCGATAAAAGTCTAG
CTGCCGGTTGCATTTTATTTTTGGTGGACACTACTTCTGCCGATGCTGTACTGCTCTTGC
AATGAACCTCACCGTTTTAAGTCATGGTTAGATTCTTACTAGGCGCTTCCAATTGCCATT
TCTTGCTCAGCCATAACCGTGAATAGTGATCCAAACGCTAATGCCGGGTGATGCTTAAAA
TTTGAAAAATTATTGCAGATTTGTATTATATAGAAAGCATAACTGGCGATGAGATGTGCT
CGAAACTGGACACCTTTACCATTGGTGACCGGTAGTGACA
Chr coordinates Chr XIV from 695595-697484
w3c xhtml validator w3c css validator