Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name DBP6
Systematic Name YNR038W
Strain S288c
Description Essential protein involved in ribosome biogenesis; putative ATP-dependent RNA helicase of the DEAD-box protein family
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>DBP6 YNR038W
CGCAGAATTCGGCTTCTTGGGCTTTAAAACCATTACACGTAATACGACACCCTTCCGCTG
GGGACACTGATCCAGTTGTGGAGCTGTACTTATCTTCTTGCGTCTTGGAGGCCCGGAGCC
TCTTTTAATCTGATTCAATGTCGCTTGCATTGTCGTAGTGGAGGAAAACAATCTCTGCGC
CTGTCTCAAGGGCGTACACCATGTGTTGGACATAAACCTCGACAACATGGCTCTTGTTGG
CCTGCTTCAATTCTGGTGTACCTGTAAGTTCTCCGTCTTTTCCCTGGTTATATGCGTTTT
TTCTCCCCAAATCGTTTTGTCGCTCGGGTAAGACTGAAATGCTTTTAAAAGCACTATTAC
TGTTTATTATGCTATATATATATATATATACAGCCCGAGTCTGGCTTGATCTTATTTACA
TGATATATCATCTAGAAATCTATATACACTAGATCCCTCATTTGTTCTTGGTTTGAGTAT
AGCTGAAACGCTTCCTGGTAGGTGCGAACTCGCCCAGTTTGTGGCCCACCATATCTTCTG
ATATTTCAATAGGTACGTACTCCTTACCATTGTGTATTTGAAATTTCAGTCCCACGAACT
GAGGAAGGATGGTGGCGGCCCTTGCGTTTGTTCTTATTGGAGTGCCCTTAGTCATGGCCT
CCCTTATGGGTAATGGCACGATGTTGGGGCCCTTCCATACGGACCGCGATAAAAGTCTAG
CTGCCGGTTGCATTTTATTTTTGGTGGACACTACTTCTGCCGATGCTGTACTGCTCTTGC
AATGAACCTCACCGTTTTAAGTCATGGTTAGATTCTTACTAGGCGCTTCCAATTGCCATT
TCTTGCTCAGCCATAACCGTGAATAGTGATCCAAACGCTAATGCCGGGTGATGCTTAAAA
TTTGAAAAATTATTGCAGATTTGTATTATATAGAAAGCATAACTGGCGATGAGATGTGCT
CGAAACTGGACACCTTTACCATTGGTGACCGGTAGTGACA
Chr coordinates Chr XIV from 695595-697484
w3c xhtml validator w3c css validator