Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name LYS9
Systematic Name YNR050C
Alias LYS13
Strain S288c
Description Saccharopine dehydrogenase (NADP+, L-glutamate-forming); catalyzes the formation of saccharopine from alpha-aminoadipate 6-semialdehyde, the seventh step in lysine biosynthesis pathway; exhibits genetic and physical interactions with TRM112
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>LYS9 YNR050C
TAACTGACGACATTTATGTACATAATTAAAATAGAAGAAAATTTTCAAAAAAAATTCTCC
TGGCGATTGTTAGGGACAAGAAAACAAGCCATGTTGTAACCAATAAATGTTACACGCCTT
CAAAATAAAAAAAAGATGGACAAAAGAGATAAATCTTTTGCTTTTTCTTACTCTGTGTTG
TTGTCAACAAAGACAACAAACGTGTGAATAATCTACGGGATTCGTTTACCATAGGCTACC
TAGAAATGGCATAGTCATGGAGATAAAGTCCCATGATATTGTAAACTAAATTGAAAGTAA
AATCAAGGAAAAAACAAGTGAGATTGCAATAAGCAATCAAGAGAGAAAAGTTTTTTGACT
GATTTTCGACTTGCTTTTATACCGATTTTGAAAAGTCGCGGGGAAAAGCTGGCAATTATT
TTTCATTTTTTTTCATTAGGGCTAGAAGTTGCTAAGAGCAAACAAACTGTTACTTGAAAG
GTTTTCCCACGTTGGTAGCTACATATGCAAGAGTCTTATGTATCGTATCTAAGTGCCACG
TAGGGGATTCCCATCATTTGATGATTTCCAAATATAATACCTGTAGAGAGCGGTGGAGCA
AAAGTCAAATTTTAATCGCAACTGCAGACAAGTCAAGCTGAGGAAATTGTGGATGATCTC
TTGTTTCTTTTGATATTCACCACAACAGAAGTGAAGAGTGTGATTGCGGTTACTACTGAC
CACGAAGCAATGCGTTTAGTAGTGAAAAGAATTACTCATACTCTGGAATCGAAATTCCGT
TGGAAAAATTCGCTTTGTAGTGAAAAATAAAGATGTCAATAAAGGGTATTGAGAATTTCC
AATGGAATTATCAGCAATAGATGATAGAAAGTAGCACAGAATTTGGCTTAATGGTATATA
AACCGTAGGGTCCTGGTAAAATTACATGGGAAGGATCCTTAGGCAGTAGGGAAAACTTAT
CAGGACAATTGAGTTATATTAACGTATTATATATTTTAAT
Chr coordinates Chr XIV from 715388-714048
w3c xhtml validator w3c css validator