Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name BRE5
Systematic Name YNR051C
Strain S288c
Description Ubiquitin protease cofactor, forms deubiquitination complex with Ubp3p that coregulates anterograde and retrograde transport between the endoplasmic reticulum and Golgi compartments; null is sensitive to brefeldin A
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>BRE5 YNR051C
TATACACAATTTTAAAAAAAAAAGTTTAAAAGCAACATCAGCTTATGATTGGACATGTAG
TAATACAGATTGGTTCTTCGATGCAATAAGCACTCTTCCACAGGAGATTGATGCGTTATT
CCCGTATAGTTATCGGTCACGTGCGCTGTAGTTTGTTTAACCATTTATTTTTTCTTGGAA
ATTTTTTCGTCCAAAGCAGCGAAAAACATCAGGTGGCGATTAATGAAAGAATGACATATT
GCAAGCAGCATAACCGTCCATTCCAGGGATAAGAGGAAGTACAAGCTTCTTTATTAATAG
TTCTAGAGTGACTACATTATTTCAGATTAGGCAATATTACCTTTTCGTACCGTTTTTTTT
TCCTGTCCACTGTTACTATTGTTACGGTTAAAAGTTCTATCGCAACCGGCGGACGTTAAA
CTAAGTCATTTGTTTTTTATCCCATTACTGTTTCAAAAAAGAGCAATTCATACCTAATTT
GTACAAAACGAAGACTGTACAAGTGGTAGTACTTGACATAGGATATTTTGCTTGAGTATT
AGAAGAATACGAAAAACTTCTTCAGTTTTCTAGTTACCGTTAGTACCAAAACTATTCTAG
AGGAAGAATAAACAGTAAGATATTGCTTTAATTTATTTATATCACCTACCACAAGCTTTC
GTTTTTTTACTCTGTTTAATTCTTCAAGTTGTGTTTTTTCCCTACATTTTAATTCATTTT
TGCCCATTTAATTACATTTTTTTTTTTGTTTTATTATTTTCGTTCAAACCTCATTTTCTT
TCAAATATTCAATTAGTCAATCATTTTACAGAGAATCTGTTGAAAACTTATTTTACTGAT
ACATCTTTATTTTTCGTTGATTTTTAAAGAGAAAAAGATCACGAAGAATACTACAAAACC
ATCGCATTTTTTTTTTCAAGTGTGTTATAGTTTTATTACCTTGTCACTAATAGTTGCATT
TGAAGTCATACCCTCGAATAGAAGTATCAAATAAAAGAAA
Chr coordinates Chr XIV from 718327-716780
w3c xhtml validator w3c css validator