Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name BIO5
Systematic Name YNR056C
Strain S288c
Description Putative transmembrane protein involved in the biotin biosynthesis; responsible for uptake of 7-keto 8-aminopelargonic acid; BIO5 is in a cluster of 3 genes (BIO3, BIO4, and BIO5) that mediate biotin synthesis
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>BIO5 YNR056C
TTTCTTGGGACATTAGTTGTTATCCTAGCAATAGAAAACGAATTGCGCTGTTGACATCCT
CCCGACCAAAAGAAAATGAAATATACAAACAATGGCTATTTATAATTCAAAATTATTGGG
CAAAACAAAATAAAATCCCGCTGGTAGTTCGTTTACTGAAGTATATAAAGAGATATACTT
TTTTCCACAAGTAGGCCAGTGAAAAGAACTCAAAAAATCACTAGCGCACAGGTCATGAAC
AGCAAATCTCAACAACAAGAACAACAACCAATTGTATTCGTCACCGGTACAGACACTGAT
GTTGGTAAAACCTTTGTATCAACATTATTGGTACACAAATGGAAAGCTGCATACTGGAAA
CCCGTACAAACTGGAATTGAGTCAGATCAAGGTGACTCCGAGACATTGAAAAATTTCAAA
ATAGCCGCATCAACTTGGCAACCACCTATATTCACGCCCACTTATGCGCTGCAGAAGCCT
CTATCTCCGCTCCAGGCCATGGAGTACGAACCTAATGTCGACATCAGGTTGTTGGATTTC
GTAGTTCCTGAAGAGTGGAGCGCAGAGAATCCATTGGTCGTAGAAGGAGCCGGCGGGGTT
TGCGTTCCTATCACTCGTAAATTGGAAATTACGACGGATCTAATTAAACATCTGATTGAG
ACTAGCGGCCATCCAGTGTACGTAGTTGTCGTGGCACGCAGCGGGCTAGGGACTCTGAAT
CATACATTGCTGACTTGGAATCATCTTTGCGATAATGGCTTGAGAAGCCACCTTTTTGGG
GTCATTCTCAATGGGGAACCGAATGAAGGCAACGTGCAGGCCCTGAAGAAGTTCGGTGTC
AATATTATGGCACAGGTTGCACAATGTACTACGGCACATGATCAGGATATGGAGTTGCAT
GAACTGCCATCGGTGGAGTCATTAATGACCCAACAAGACGTAGAATAGTTTAAATAAAAA
AGTTGCAAGGCTTTCATCAGCTATATATAAGTAGCATGGT
Chr coordinates Chr XIV from 733303-731618
w3c xhtml validator w3c css validator